Examen M1 BTV - Bioinformatique - Avril 2016

Questions de la PARTIE 2

Aller au NCBI. Dans le menu déroulant, sélectionner le champs "Protein". Récupérer les séquences FASTA correspondant aux N° d'accession suivants :

AAB38782 AAU87300 AAV92687 AAY78769 ABA54779 AAA63614 ABD28561 ACA49509 NP_181781 NP_565306 EEF39286

  • A quelle(s) famille(s) de protéines appartiennent ces séquences ?
  • De quel(s) règne(s) ?

Aller à TargetP 1.1.

Coller les séquences dans la fenêtre.
Cocher le bouton correct pour l'option "Organism group".
Option "Prediction scope" : cocher le bouton "Perform cleavage site predictions".
Ne pas s'occuper de "Cutoffs".
Puis "Submit".

  • Combien de séquences sont prédites chloroplastiques et combien sont prédites mitochondriales ?
  • Quelles sont les longueurs respectives du plus petit et du plus long peptide signal ?

Questions de la PARTIE 3

1. Récupérer la séquence ci-dessous.

>Sequence Proteine X
TCGACATTATATGATTTTAAATCAATTCCGTTTCTAATTTATAATTATTTCGTTAAACCAATCAATTCCC
TTTAAACACTGCTTATGCATATTCTGTCTCAATTTATATATGGCATTGCATTCTTCCGTATTAATTTATA
AGTTCACTTTTTATTGATCAAGTATTTGTGGTTTTCTTTATATAAAAAAATGTATTAGTGTTTTTCTGTA
TTAATTTTATAAGTTCATCTTTATGAGAATGCTAATGTATTTGGACAGCCAATAAAATTCCAGAATTGCT
GCAATCAAGGATGAAACCGGGAGGAAATACTATTGTAATATGGATGTATGCAGTGGCAACATGGCTTTGT
TTTGGATCCACCTCAGGGTGGTCTTTCACATTAGAGGATAACAACATATTCCCCAAACAATACCCAATTA
TAAACTTTACCACAGCGGGTGCCACTGTGCAAAGCTACACAAACTTTATCAGAGCTGTTCGCGGTCGTTT
AACAACTGGAGCTGATGTGAGACATGAAATACCAGTGTTGCCAAACAGAGTTGGTTTGCCTATAAACCAA
CGGTTTATTTTAGTTGAACTCTCAAATCATGCAGAGCTTTCTGTTACATTAGCGCTGGATGTCACCAATG
CATATGTGGTCGGCTACCGTGCTGGAAATAGCGCATATTTCTTTCATCCTGACAATCAGGAAGATGCAGA
AGCAATCACTCATCTTTTCACTGATGTTCAAAATCGATATACATTCGCCTTTGGTGGTAATTATGATAGA
CTTGAACAACTTGCTGGTAATCTGAGAGAAAATATCGAGTTGGGAAATGGTCCACTAGAGGAGGCTATCT
CAGCGCTTTATTATTACAGTACTGGTGGCACTCAGCTTCCAACTCTGGCTCGTTCCTTTATAATTTGCAT
CCAAATGATTTCAGAAGCAGCAAGATTCCAATATATTGAGGGAGAAATGCGCACGAGAATTAGGTACAAC
CGGAGATCTGCACCAGATCCTAGCGTAATTACACTTGAGAATAGTTGGGGGAGACTTTCAACTGCAATTC
AAGAGTCTAACCAAGGAGCCTTTGCTAGTCCAATTCAACTGCAAAGACGTAATGGTTCCAAATTCAGTGT
GTACGATGTGAGTATATTAATCCCTATCATAGCTCTCATGGTGTATAGATGCGCACCTCCACCATCGTCA
CAGTTTTCTTTGCTTATAAGGCCAGTGGTACCAAATTTTAATGCTGATGTTTGTATGGATCCTGAGCCCA
TAGTGCGTATCGTAGGTCGAAATGGTCTATGTGTTGATGTTAGGGATGGAAGATTCCACAACGGAAACGC
AATACAGTTGTGGCCATGCAAGTCTAATACAGATGCAAATCAGCTCTGGACTTTGAAAAGAGACAATACT
ATTCGATCTAATGGAAAGTGTTTAACTACTTACGGGTACAGTCCGGGAGTCTATGTGATGATCTATGATT
GCAATACTGCTGCAACTGATGCCACCCGCTGGCAAATATGGGATAATGGAACCATCATAAATCCCAGATC
TAGTCTAGTTTTAGCAGCGACATCAGGGAACAGTGGTACCACACTTACAGTGCAAACCAACATTTATGCC
GTTAGTCAAGGTTGGCTTCCTACTAATAATACACAACCTTTTGTGACAACCATTGTTGGGCTATATGGTC
TGTGCTTGCAAGCAAATAGTGGACAAGTATGGATAGAGGACTGTAGCAGTGAAAAGGCTGAACAACAGTG
GGCTCTTTATGCAGATGGTTCAATACGTCCTCAGCAAAACCGAGATAATTGCCTTACAAGTGATTCTAAT
ATACGGGAAACAGTTGTCAAGATCCTCTCTTGTGGCCCTGCATCCTCTGGCCAACGATGGATGTTCAAGA
ATGATGGAACCATTTTAAATTTGTATAGTGGGTTGGTGTTAGATGTGAGGGCATCGGATCCGAGCCTTAA
ACAAATCATTCTTTACCCTCTCCATGGTGACCCAAACCAAATATGGTTACCATTATTTTGATAGACAGAT
TACTCTCTTGCAGTGTGTATGTCCTGCCATGAAAATAGATGGCTTAAATAAAAAGGACATTGTAAATTTT
GTAACTGAAAGGACAGCAAGTTATTGCAGTCCAGTATCTAATAAGAGCACAACTATTGTCTTGTGCATTC
TAAATTTATGGATGAATGTATGAATAAAGCTAATTATTTTGGTCATCAGACTTGATATCTTTTTGAATAA
AATAAATAATAATGTTTTTTCAAACTTATAAAACTAATGAATGATATGAATATAAATGCGGAGACTAGTC
AATCTTTTATGTAATTCTATGATGATAAAAGCTT

2. Aller à "Expasy Proteomics tools".

3. Traduire cette séquence nucléotidique et choisir la phase de traduction la plus probable.

  • Enregistrer la séquence traduite au format FASTA.
  • Dans la page de résultat, repérer "Sequence analysis tools" : quelle est la masse molaire moyenne de la séquence traduite ? Quel est le pI ?

3. Faire un "BLAST" avec la séquence traduite. Choisir le fichier qui renvoie la meilleure "e-value".

  • De quelle protéine s'agit-il très probablement ?
  • Préciser le N° d'accession, l'organisme, le nombre d'acides aminés.
  • S'agit-il d'une enzyme ? Si oui, quel est son N° EC ?

4. Aller à la "Protein Data Bank". Rechercher le fichier 2AAI.

Dans le menu "Display files", choisir "PDB File". Entre quelles cystéines de la chaîne A et de la chaîne B s'établit-il un pont disulfure ?

Valid XHTML 1.0 Transitional