Travaux dirigés de biochimie et de régulation métabolique
Tweet

A. Transduction du signal

1. Décrire en quelques phrases avec une vingtaine de mots-clés la figure ci-contre.

voie signalisation acide arachidonique signalisation recepteur RCPG phosphorylation calmoduline metabolisme energie energetique glucose PKF glycolyse metabolomique metabolomics sequence alignment RNAi interference ARN biochimej

2. Faire un tableau décrivant les différents types de récepteurs et leurs principales caractéristiques.

3. Expliquer la multiplicité des cibles compte-tenu des possibilités de complexes [récepteur couplé à une protéine G - protéines G].

B. Métabolisme du glucose - contrôle allostérique de la glycolyse

1. Détailler le rôle de l’insuline, de GLUT4 et du glucagon dans la régulation de la glycolyse.

2. Sélectionner dans la liste suivante de molécules et de voies métaboliques (mentionnées dans n’importe quel ordre), celles qui sont susceptibles d’intervenir dans l’[homéostasie du glucose / métabolisme énergétique aérobie] :

glycogène synthétase, F1,6BP, ATP, photosynthèse, mitochondrie, Ser/Thr protéines phosphatases, sphingomyèline, glycogène, histone, protéine G, adénylate cyclase, phospholipase A2, citrate, PFK1, thrombine, F2,6BP, enzyme de la néoglucogénèse, récepteur à activité tyrosine kinase, cytochrome C, oxaloacétate, glucagon, cytokine, AMP, transducine, CDPK, acétylCoA, urée, ATP synthase, Ca2+, AMPc, inositol 3-phosphate, pyruvate kinase, adrénaline, PFK2, glycolyse, entrée/sortie du glucose libre, NADH, calmoduline, diacylglycérol, épinéphrine, FADH2, phosphatidyl 4,5-bisphosphate, protéasome 19S, glycogène phosphorylase, cycle de Krebs, domaine DBD à « doigt de zinc », pyruvate, cystéine, acétyl-CoA, glucose 6 phosphate, cadhérine, transporteur GLUT4, ARN polymérase, insuline, nitrate réductase, MAP kinase p38, récepteur couplé à une protéine G, ubiquitine, protéine kinase A, hémoglobine, hexokinase, transaminase, glucose, fer, muscle.

3. Faire un schéma de l’[homéostasie du glucose / métabolisme énergétique aérobie] sur la base des mots retenus dans cette liste.

2. Les courbes ci-dessous représentent la vitesse de la réaction catalysée par la PFK1 en fonction de la concentration d’ATP, du citrate et du NADH.

Regulation activite PFK1 signalisation recepteur RCPG phosphorylation calmoduline metabolisme energie energetique glucose PKF glycolyse metabolomique metabolomics sequence alignment RNAi interference ARN biochimej

a. Sur la base du schéma précédent, interprétez l’allure des courbes obtenues pour l’ATP et le citrate.

b. Etablir un lien entre l’activité de la PFK1 et la concentration du NADH (glycolyse et cycle de Krebs).

C. Déshydrogénase à NAD(P)+.

1. Aller au NCBI. Rechercher les séquences de la lactate déshydrogénase. Attention : anglais, abréviation, Booléens.

Dans "Advanced", affinez la recherche avec EC 1.1.1.27 dans les résultats précédents.

2. A quoi correspond EC 1.1.1.27 ? Chercher un fichier correspondant dans la base de données Uniprot.

3. Qu’est-ce que FASTA (séquence) et FASTA (programme) ?

4. Faire une recherche de séquences homologues et/ou similaires de la lactate déshydrogénase de l’homme avec BLAST. Les chaines sont-elles identiques ?

5. Effectuer une prédiction de structures secondaires avec un outil approprié. Essayer de repérer les acides aminés du Pli Rossmann en s’appuyant sur les données du fichier Uniprot.

Exemples d’outils :

D. CaM kinases II et protéines kinases calcium dépendantes

Comparez les structures et les modes de fonctionnement de la CAM kinase II et de la CDPK en indiquant clairement les points communs et leurs spécificités.

Retour haut de page

 

E. Calmoduline

1. Voici un exemple de syntaxe PROSITE : <A-x-[ST](2)-x(0,1)-{V}

Elle se lit : Ala en position N-terminale puis n'importe quel acide aminé puis 2 fois (Ser ou Thr) suivie ou non par n'importe quel acide aminé puis n'importe quel acide aminé sauf Val.

a. Ecrire la séquence suivante dans cette syntaxe : 4 Ser puis (Asp ou Ser) puis (Asp ou Glu) puis n'importe quel acide aminé puis (Asp ou Glu) puis (Glu ou Gly ou Val) puis 1 à 7 fois n'importe quel acide aminé puis (Glu ou Gly) puis 1 à 2 fois n'importe quel acide aminé puis 4 fois (Arg ou Lys).

b. Ecrire la séquence consensus du motif de fixation du calcium (motif "EF-hand") dans la syntaxe PROSITE.

2. Effectuer une recherche de séquence de la calmoduline de l’homme au NCBI.

3. Effectuer une recherche de séquences homologues ou similaires avec PHI-Blast à partir de cette séquence de calmoduline et du motif de fixation du calcium.

4. Emettre une hypothèse pour expliquer que la calmoduline reconnait autant de cibles distinctes bien qu’il y ait une très forte homologie de séquence en acides aminés entre les calmodulines.

F. Interférence ARN

Cet exercice nécessite de lire le cours Interférence ARN.

chalcone synthase petunia suppresion gene signalisation recepteur RCPG phosphorylation calmoduline metabolisme energie energetique glucose PKF glycolyse metabolomique metabolomics sequence alignment RNAi interference ARN biochimej

Source : Napoli et al. (1990) Plant Cell 2, 279 - 289

 

interference ARN RNAi siRNA miRNA chalcone synthase petunia signalisation recepteur RCPG phosphorylation calmoduline metabolisme energie energetique glucose PKF glycolyse metabolomique metabolomics sequence alignment biochimej

Source figures: Napoli et al. (1990) Plant Cell 2, 279 - 289

interference ARN RNAi siRNA miRNA chalcone synthase petunia signalisation recepteur RCPG phosphorylation calmoduline metabolisme energie energetique glucose PKF glycolyse metabolomique metabolomics sequence alignment biochimej

1. Analyser ces résultats. Quel phénomène traduisent-ils ?

2. Trouver la séquence d’un siRNA dans la séquence de l’ARN messager codant la vimentine de l’homme : Homo sapiens vimentin mRNA, NM_003380.

> gi|240849334|ref|NM_003380.3| Homo sapiens vimentin mRNA

GGGCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCGTTCGCC TCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAG CCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCA CCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCC TGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCG TGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCC TGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCC GCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACA AGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGG GCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGC AGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCG

Les règles de conception d’un siRNA à partir d’une séquence d’ARM messager sont :

  • Targets should be located 50-100 nt downstream of the start codon (ATG).
  • Search for sequence motif AA(N19)TT or NA(N21), or NAR(N17)YNN, where N is any nucleotide, R is purine (A, G) and Y is pyrimidine (C, U).
  • Target sequences should have a G+C content between 35-60%.
  • Avoid stretches of 4 or more nucleotide repeats.
  • Avoid 5'URT and 3'UTR, although siRNAs targeting UTRs have been shown to successfully induce gene silencing.
  • Avoid sequences that share a certain degree of homology with other related or unrelated genes.

3. Faire un schéma de "filiation" des différents intermédiaires dans l'interférence ARN (pri-miRNA, pre-miRNA ...).

Readseq : "biosequence conversion tool"

G. Néoglucogénèse et glycogènolyse.

1. Quels sont les deux principaux points de contrôle de la régulation de la néoglucogenèse et quelles sont les quatre enzymes spécifiques de cette voie ?

2. De quelle façon la caféine agit-elle pour stimuler la glycogénolyse ?

Retour haut de page

 

H. Reconstruction métabolique - approche bioinformatique de la régulation du métabolisme.

Cet exercice nécessite de lire le cours Métabolomique et de télécharger les articles mentionnés ci-dessous (accessibles en ligne via les liens).

1. Modèle général et stratégies

Sur la base des articles suivants, faire un schéma de la démarche générale de la reconstruction métabolique à l'échelle d 'un génome.

a. Article : Lee et al. (2008) "Dynamic Analysis of Integrated Signaling, Metabolic, and Regulatory Networks" PLoS Comput. Biol. 5

Voir aussi : "Supporting information - Text S1" - "Prototypic Integrated System"

b. Article : Durot et al. (2009) "Genome-scale models of bacterial metabolism: reconstruction and applications" FEMS Microbiol. Rev. 33, 164 – 190

Voir en particulier :

  • "Fig. 1 - Genome-scale modeling of metabolism"
  • "Table 4 : Existing genome-scale metabolic models for bacterial organisms"

c. Article : Oberhardt et al. (2008) "Genome-Scale Metabolic Network Analysis of the Opportunistic Pathogen Pseudomonas aeruginosa PAO1" J Bacteriol. 190, 2790 - 2803

Voir en particulier :

  • "Fig. 2 - Schematic of the network reconstruction process for iMO1056 »
  • "Fig. 3 - S matrix"
2. Base de données de modèles : "Biomodels" - EBI

Aller à : BioModels Database - A Database of Annotated Published Models

Cliquer sur le lien : "Browse models using GO"

  • Ouvrir l'arborescence : "GO:0008150 biological_process (422)"
    • Ouvrir l'arborescence : "GO:0023052 signalling (169)"
      • Ouvrir l'arborescence : "GO:0023051 regulation of signalling (63)"
        • Ouvrir l'arborescence : "GO:0009966 regulation of signal transduction (53)"
          • Ouvrir l'arborescence : "GO:0008277 regulation of G-protein coupled receptor protein signaling pathway (3)"
            • Ouvrir l'arborescence : "GO:0045745 positive regulation of G-protein coupled receptor protein signaling pathway (1)"
              • Partie droite de la fenêtre : cliquer sur le modèle BIOMD0000000145 - Wang2007_ATP_induced_Ca_Oscillator

a. Quel type de signal ce modèle essaye-t-il de modéliser ?

b. Faire le lien entre les informations contenues dans l'onglet "Math" et le modèle décrit ci-contre.

Source : Wang et al. (2007)

Modele oscillation calcique signalisation recepteur RCPG phosphorylation calmoduline metabolisme energie energetique glucose PKF glycolyse metabolomique metabolomics sequence alignment RNAi interference ARN biochimej

c. Dans le menu déroulant "Actions" :

  • Choisir : "View Bitmap Recation Graph". Faire le lien entre le modèle obtenu et les informations contenues dans l'onglet "Math".
  • Choisir : "View Dynamic Reaction Graph" (Applet java) pour visualiser le réseau d'interactions. Les différentes interactions sont obtenues en cliquant sur les composés du modèle.
  • Choisir : "BioModels Online Simulation" pour visualiser la simulation de la cinétique d'évolution du modèle.

d. Quelle information obtient-on dans l'onglet «Physical entities» ?

3. Exercice d'application

Faire le schéma de l'ensemble des réactions associées à la matrice de stoechiomètrie S suivante :

  R1 R2 R3 R4 R5 R6
M1 -1 0 0 0 0 0
M2 +1 -1 -1 0 0 0
M3 0 +1 0 -1 +1 0
M4 0 0 +1 +1 -1 -1
M4 0 0 0 0 0 +1

Retour haut de page

 

I. Justifier le choix de la ou des réponse(s).

1. a) l'ATP et le GTP sont "activés" par phosphorylation - b) l'ATP est "activé" et le GTP est "inactivé" par phosphorylation - c) l'ATP est inactivé et le GTP est inactivé par hydrolyse - d) l'ATP est activé et le GTP inactivé par hydrolyse.

2. L'augmentation de la concentration intracellulaire du calcium : a) résulte de l'activation des pompes à calcium - b) peut se faire par libération du calcium à partir du R.E. - c) est impliquée dans la phosphorylation des tyrosines.

3. La protéine G hétérotrimérique : a) contient 3 types de sous-unité - b) une fois activée, diffuse librement le long de la membrane plasmique - c) amplifie la cascade intracellulaire de signalisation - d) peut-être associée au récepteur b-adrénergique.

4. Cascade de la signalisation dans le photorécepteur de la rétine : a) l'absorption des photons ferme des canaux sodiques ce qui induit une dépolarisation membranaire du récepteur - b) la protéine G du photorécepteur s'appelle la calmoduline - c) la protéine G agit, via une phosphodiestérase sur le GMPc qui est le second messager du photorécepteur.

5. La phospholipase C : a) est un récepteur à 7 domaines transmembranaires - b) est activée par la sous-unité a de la protéine associée au GDP - c) transforme l'IP3 en inositol phospholipidique et en DAG - d) permet la libération d'un second messager et l'activation d'une protéine kinase - e) est impliquée dans la voie de transduction des récepteurs à 7 domaines transmembranaires.

6. L'AMP cyclique : a) est un second messager qui peut activer les protéines kinases - b) l'AMPc phosphodiestérase augmente la synthèse de l'AMPc - c) l'adénylate cyclasse diminue le taux d'AMPc - d) permet la synthèse d'ATP et donc augmente l'activité des protéines kinases.

7. L'activation du récepteur de la rhodopsine: a) aboutit à la formation de GMPc et à la fermeture de canaux sodiques - b) aboutit à la formation de GMPc à partir de GTP par une guanylate cyclase - c) aboutit à l'activation de la protéine G de type Gt - d) aboutit à l'activation de la GMPc phosphodiestérase et à la formation de GMP - d) aboutit à la diminution du taux de GMPc et à augmentation de la concentration du sodium dans le cytoplasme.

8. Les récepteurs nucléaires : a) sont activés par des protéines G - b) sont importés vers le cytoplasme en présence de l'hormone - c) sont des facteurs de transcription en présence de l'hormone - d) fixent l'ADN via leur domaine en doigt de zinc en présence de l'hormone - e) sont transmembranaires et transportés dans le noyau en présence de leurs ligands.

9. Le doigt de zinc est une partie de la structure : a) d'un site de liaison intracellulaire d'un RCPG - b) de la sous-unité a d'une protéine G - c) du domaine de fixation à l'ADN d'un récepteur nucléaire - d) du domaine d'activation d'un récepteur couplé à une activité enzymatique.

10. La transduction d'un signal extracellulaire mettant en jeu l'adénylyl cyclase se déroule en plusieurs étapes : a) hydrolyse du GTP en GDP par les protéines G - b) fixation du médiateur chimique (ligand) sur son récepteur spécifique et changement de conformation du récepteur - c) hydrolyse de l'ATP et cyclisation de l'AMP par l'adénylyl cyclase - d) remplacement du GDP par du GTP sur la protéine G (échange) - e) formation du complexe protéine G-adénylyl cyclase - f) activation d'une cascade de phosphorylation.

Dans quel ordre chronologique se déroulent les étapes ?

  • a) 1, 2, 5, 3, 6, 4
  • b) 2, 1, 5, 3, 6, 4
  • c) 2, 1, 5, 3, 4, 6
  • d) 2, 4, 6, 3, 1, 5
  • e) 2, 4, 5, 3, 6, 1

11. Après stimulation de cellules en culture par l'adrénaline, on observe une augmentation de la concentration du calcium libre dans le cytosol. On peut penser que : a) ces cellules n'ont pas de calmoduline - b) toutes les S/T protéines kinases cytosoliques peuvent être activées - c) une activation des pompes à calcium peut s'ensuivre - d) il y aura une désensibilisation de tous les RCPG trimériques.

12 : Quelle est la réponse de l’organisme lorsque la glycémie augmente ? a) Le glucagon induit la libération du glucose par les cellules hépatiques -  b) Le glucagon induit le stockage du glucose sous forme de glycogène dans les cellules hépatiques et musculaires et sous forme de triglycérides dans les cellules adipeuses - c) L’insuline induit la libération du glucose par les cellules hépatiques - d) L’insuline induit le stockage du glucose sous forme de glycogène dans les cellules hépatiques et musculaires et sous forme de triglycérides dans les cellules adipeuses.

13. Question la plus difficile : Posez une question pertinente sur la régulation du métabolisme.

[Questions inspirées des TD de Biologie cellulaire / Signalisation - Faculté de médecine Bichat & Lariboisière]

J. Récepteurs et insuline

1. Aller à la base de données dédiées aux RCPG : "GPCRDB : Information system for G protein-coupled receptors".

Onglet "Search" => Fenêtre "Protein search" => champs "Description" => taper "serotonin".

Exercice d'alignement de séquences de la famille des récepteurs de la sérotonine de type 1A.

  • Cliquer sur le lien "Serotonin type 1a"
  • Cliquer sur le lien "Alignments & Analyses", puis "Download alignments (fasta)". Copier quelques séquences au format FASTA.
  • Aller à un logiciel d'alignement de séquences (exemple : Multalin).
  • Coller les séquences et lancer le programme.

Remarques :

  • l'onglet "MView alignment" permet de visualiser directement des alignements.
  • l'onglet "JalView multiple sequence alignment" nécessite l'activation de Java dans le navigateur.

Tirer des conclusions quant à la nature des acides aminés conservés.

2. Recherches de séquences de récepteurs.

a. Aller à Uniprot.

  • Taper : "ENSRNOP00000013618" dans la fenêtre "Query".
  • Cliquer sur le lien G3V7B9 dans la colonne "Entry".

Décripter les informations.

b. Récupérer le fichier : "FastaRecepMamm".

Effectuer un alignement multiple. Tirer des conclusions.

3. Insuline.

a. Aller au NCBI. Effectuer une recherche de récepteur de l'insuline de l'homme. Quels mots-clés faut-il employer ?

Analyser le contenu résultat du fichier dont le N° d'accession est : AAA59452.

b. Effectuer une recherche avec BLAST.

Comparer la figure "Putative conserved domains detected" à celle du cours sur le récepteur de l'insuline.

c. Rechercher les fichiers dont les N° d'accession sont les suivants :

  • AAA59179
  • NP_000198
  • NP_001008996
  • Q8HXV2
  • P30407
  • AEG19452
  • ABB89743
  • ABB89749
  • ABI63346

Effectuer un alignement multiple. Tirer des conclusions.

 

Valid XHTML 1.0 Transitional         Flux RSS Retour haut de page