Premières expériences de l'interférence ARN ("RNA interference" - RNAi) - Conception de siRNA

1. Découverte de l'interférence ARN

2. Résultats expérimentaux de Napoli et al. (1990)

3. Conception d'un siRNA

4. Liens Internet et références bibliographiques

 

Voir le cours sur l'interférence ARN.

1. Découverte de l'interférence ARN

En 1990, Napoli, Lemieux & Jorgensen ont été les premiers à décrire un phénomène d'interférence ARN, sans savoir qu'il s'agissait de ce mécanisme.

L'objectif de leur étude était de déterminer si la chalcone synthase (CHS), une enzyme clé de la biosynthèse des flavonoïdes, est l'enzyme limitante dans la voie de biosynthèse de l'anthocyane à l'origine de la coloration violette profonde du pétunia.

petunia RNA interferent siRNA miRNA anthocyane anthocyanidine interfering RNA biochimej

Les anthocyanes sont des pigments hydrosolubles vacuolaires rouges, violets ou bleus selon le pH.

Ils appartiennent aux flavonoïdes synthétisées par la voie des phénylpropanoïdes.

Les anthocyanes dérivent des anthocyanidines par addition d'oses (sur R3).

petunia RNA interferent siRNA miRNA anthocyane anthocyanidine interfering RNA biochimej

Napoli, Lemieux & Jorgensen ont surexprimé la CHS en introduisant dans des pétunias un transgène codant une CHS exogène :

  • étonnament, 42% des pétunias dans lesquels le gène CHS a été introduit, ont blanchi
  • seulement 9% des fleurs contrôle ont blanchi
  • le niveau de [CHS endogène + CHS introduite] étaient 50 fois inférieur au niveau de CHS du pétunia de type sauvage.

Retour haut de page

 

2. Résultats expérimentaux de Napoli et al. (1990)

a. Cinétique du taux d'ARN messager codant la CHS endogène au cours du développement de fleurs violettes contrôle

Les pétales ont été récoltés à différents stades de développement, à partir de fleurs colorées en violet d'un plant contrôle (V26) qui ne contient pas le transgène CHS.

Figure ci-contre : autoradiogramme des ARN protégés contre les RNAses issus de ces fleurs.

Dans ces fleurs contrôle, le taux d'ARN messager codant la CHS endogène augmente jusqu'à une taille de corolle de 40 mm puis décroit jusqu'à la maturation de la fleur.

Piste 1 : ADN de pBR322 digéré par HpaII (marqueur de taille de fragments).

petunia RNA interferent siRNA miRNA biochimej

b. Cinétique du taux d'ARN messager (codant la CHS) issu du gène endogène et du transgène introduit dans des fleurs blanches du plant trangénique 218.38

Les pétales ont été récoltés à différents stades de développement, à partir de fleurs totalement blanches d'un plant transgénique appelé 218.38.

Ce plant contient le gène codant la CHS endogène et le transgène CHS introduit.

Piste 1 : ADN de pBR322 digéré par HpaII (marqueur de taille de fragments)

Piste 2 : sonde non digérée

Piste 3 : ARN messagers de fleurs contrôle issus d'une corolle de 40 mm (équivalent à la piste 4 du gel précédent)

Pistes 4 à 9 : ARN messagers (protégés contre les RNAses) issus d'une corolle de 15 mm, 30 mm, 40 mm, 53 mm et 58 mm (2 fois) de fleurs transgéniques 218.38 (ligne E : CHS endogène - ligne I : transgène CHS)

Piste 10 : ARN de transfert (contrôle négatif)

E : fragment (96 pb) de l'ARN messager (protégé contre les RNAses) codant la CHS endogène

Le gène codant les ARN messagers de la CHS n’est pas altéré : vérifié par séquençage de sa région codante et comparaison avec la séquence du clone d’ADNc dont il est dérivé.

 

petunia interference ARN siRNA miRNA biochimej

Conclusions

a. La cinétique du taux d'ARN messager codant la CHS endogène (bandes E / pistes 4 à 9 - gel ci-dessus) du plant transgénique 218.38 est identique à la cinétique observée pour les fleurs non transformées (plantes contrôle - pistes 2 à 6 - gel précédent)

b. MAIS à chaque stade de développement (pistes 4 à 9), le taux d'ARN messager codant la CHS endogène est 50 fois inférieur à celui des fleurs contrôle (énorme tache de la piste 3 - gel ci-dessus).

c. La cinétique du taux d'ARN messager codant la CHS transgène (bandes I / pistes 4 à 9 - gel ci-dessus) du plant transgénique 218.38 est constant quelque soit le stade de développement.

d. MAIS à chaque stade de développement (pistes 4 à 9), le taux d'ARN messager codant la CHS transgène est aussi nettement inférieur à celui des fleurs contrôle (énorme tache de la piste 3).

Donc la quantité d'ARN messagers de [CHS endogène + CHS introduite] des fleurs blanches du plant transgénique 218.38 est environ 50 fois inférieure à la quantité des ARN messagers de CHS endogène des fleurs contrôle violette.

Quand le transgène, prévu pour sur-produire les ARN messagers codant la CHS, est introduit, il entraine la diminution du nombre de transcrits issus de la transcription du gène endogène homologue : les ARN messagers codant la CHS sont dégradés.

L'interférence ARN ("RNA interference") ou RNAi est une voie de régulation du taux d'ARN messagers ou plus précisément de l'expression post-transcriptionnelle des gènes.

Andrew Fire et Craig Mello ont obtenu le Prix Nobel en 2006 pour l'explication des bases de ce mécanisme ("RNA interference - gene silencing by double-stranded RNA") chez le nématode Caenorhabditis elegans (travaux publiés en 1998).

Appellations historiques :

  • "cosuppression" chez le pétunia
  • "post transcriptional gene silencing" chez les plantes
  • "quelling" (étouffement) - Romano et Macino (1992) : phénomène identique chez Neurospora crassa
  • "RNA interference" (Fire & Mello)

chronologie RNA interferent siRNA miRNA biochimej

Deux types de petits ARN jouent un rôle central dans le mécanisme de l'interférence ARN:

a. Les siRNA ("small interfering RNA") ou petits ARN interférents :

  • ils sont d'origine extérieure à la cellule cible (ARN double brin exogène de virus) ou propres à la cellule (ARN double brin endogène).
  • ils ont une complémentarité parfaite avec la séquence de l'ARNm cible, ils induisent une inhibition (répression) de la transcription par modification de la chromatine ou ils induisent le clivage de l'ARN messager cible.

b. Les miRNA ("micro RNA") ou micro ARN :

  • ils sont codés par le propre génome de la cellule (ARN non-codant endogène).
  • ils sont impliqués dans la régulation de la transcription des gènes au niveau post-transcriptionnel. Chez l'homme, on estime que au moins 30% des gènes sont régulés par des miRNA.
  • si ils ont une complémentarité parfaite avec la séquence de l'ARNm cible, ils induisent une inhibition (répression) de la transcription ou ils induisent le clivage de l'ARN messager cible.
  • si ils ont une complémentarité imparfaite avec la séquence de l'ARNm cible, ils induisent une inhibition (répression) de la traduction de l'ARN messager cible.

D'autres types de petits ARN interférant jouent des rôles importants dans la régulation de la transcription des gènes.

Retour haut de page

 

3. Conception d'un siRNA

L'introduction d'ADN double brin ("double-strand DNA" - dsRNA) de plus de 30 nucléotides dans des cellules de mammifères induit la réponse interféron : activation de la protéine kinase R ("interferon-induced, double-stranded RNA-activated protein kinase" ou EIF2AK2) et de la 2',5'-oligoadénylate synthétase.

Cette réponse entraîne la dégradation non spécifique des ARN messagers donc une diminution de la quantité des protéines codées par ces ARN messagers.

La conception ("design" / "screening") de siRNA nécessite donc que les ARN synthétisés contiennent moins de 30 nucléotides.

Les siRNA avec un débordement en 3’ constitué du dinucléotide UU sont les plus puissants.

Synthese siRNA RNA interferent miRNA biochimej

Les règles de conception d’un siRNA à partir d’une séquence d’ARN messager sont :

  • siRNA targeted sequence is usually 21 nt in length.
  • Avoid regions within 50-100 bp of the start codon (ATG) and the termination codon. Targets should be located 50-100 nt downstream of the start codon.
  • Search for sequence motif AA(N19)TT or NA(N21), or NAR(N17)YNN, where : A = Adenine; T = Thymine; N = any nucleotide; R = purine (A, G); Y = pyrimidine (T, C, U).
  • Target sequences should have a [G+C] content between 30-60%.
  • Avoid stretches of 4 or more nucleotide repeats such as AAAA, CCCC.
  • Avoid intron regions, repeats and low complex sequences, single nucleotide polymorphism (SNP) sites.
  • Avoid 5'UTR and 3'UTR, although siRNAs targeting UTRs have been shown to successfully induce gene silencing.
  • Avoid sequences that share a certain degree of homology with other related or unrelated genes : perform BLAST homology search to avoid off-target effects on other genes or sequences.
  • Always design negative controls by scrambling targeted siRNA sequence. The control RNA should have the same length and nucleotide composition as the siRNA but have at least 4-5 bases mismatched to the siRNA. Make sure the scrambling will not create new homology to other genes.

Readseq : "biosequence conversion tool"

Application

Trouver la séquence d’un siRNA dans la séquence de l’ARN messager codant la vimentine de l’homme : Homo sapiens vimentin mRNA, NM_003380.

gi|240849334|ref|NM_003380.3| Homo sapiens vimentin mRNA

GGGCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCGTTCGCC TCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAG CCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCA CCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCC TGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCG TGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCC TGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCC GCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACA AGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGG GCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGC AGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCG

  • On cherche le codon d'initiation de la transcription (AUG ou ATG sous forme d'ADNc).
  • Puis, toutes séquences qui commence par un dinucléotide AA + les 19 nucléotides suivants (soit 21 nucléotides dans l’ARNm cible) constituent un site cible potentiel pour les siRNA.

Recherche du codon d'initiation (AUG ou ATG sous forme d'ADNc) et de la séquence codant la vimentine

  • Aller à "ORF Finder" (NCBI).
  • Coller la séquence complète de l'ARN messager ou le N° d'accession (NM_003380). Cliquer sur le bouton "OrfFind".
  • Cliquer sur le petit carré vert qui correspond à la traduction la plus longue (Frame = +3).
  • Cliquer sur le bouton "Accept".
  • Menu déroulant : choisir "3 Fasta protein". Cliquer sur le bouton "View".

Copier la séquence traduite.

Revenir à à "ORF Finder".

  • Dans le menu déroulant, choisir "2 Fasta nucleotide". Cliquer sur le bouton "View.
  • Récupérer la séquence codant la vimentine avec l'ATG d'initiation correct (séquence codant la vimentine).
  • Comparer cette séquence avec celle de la figure ci-dessous à partir de l'ATG écrit en rouge.

Conception du siRNA : recherche de séquences qui commence par un dinucléotide AA + 19 nucléotides

Ci-contre : exemple de séquence de siRNA pour la vimentine de l'homme obtenu avec le programme AsiDesigner (voir ci-dessous).

Vimentine RNA interferent siRNA miRNA biochimej


Résultat pour la vimentine
séquence ciblée - ADNc ("targeted region") 5' AACTACATCGACAAGGTGCGCTT
siRNA sens 5' CUACAUCGACAAGGUGCGCdTdT
siRNA antisens 5' GCGCACCUUGUCGAUGUAGdTdT

Autres exemples

Lamine A/C
SC : 5'AACTGGACTTCCAGAAGAACATC
sens : 5'CUGGACUUCCAGAAGAACAdTdT
antisens : 5'UGUUCUUCUGGAAGUCCAGdTdT

Lamine B1
SC : 5'AACGCGCTTGGTAGAGGTGGATT
sens : 5'CGCGCUUGGUAGAGGUGGAdTdT
antisens : 5'UCCACCUCUACCAAGCGCGdTdT

GL2 Luciferase
SC : 5'AACGTACGCGGAATACTTCGATT
sens : 5'CGUACGCGGAAUACUUCGAdTdT
antisens : 5'UCGAAGUAUUCCGCGUACGdTdT

Source : Elbashir et al. (2001) / Tuschl Lab "The siRNA user guide"

Exemples de programmes

IDT - "Design siRNA following the rules of either Thomas Tuschl or Andrew Fire" : conception de dsRNA 27mers.

  • Entrer le nom de la séquence. Coller la séquence cible.
  • Ou rapatrier la séquence du NCBI.
  • Puis cliquer sur "Calculate".
  • Voir les différentes positions des siRNA sens trouvés.

TROD - "T7 RNAi Oligo Designer"

AsiDesigner

  • Etape 1 : Vérifier la taxonomie (fenêtre de gauche) et le type d'information soumise.
  • Taper : NM_003380 dans la fenêtre "C. Target mRNA information".
  • Cliquer sur "Submit target mRNA information".
  • Etape 2 : Reherche d'isoformes : cliquer sur le bouton "Find isoforms".
  • Etape 3 : Choisir l'isoforme selon les résultats obtenus. Cliquer sur le bouton "Design".
  • Etape 4 : Modifier les valeurs pour la conception du siRNA en fonction de la séquence cible et des régles énoncées ci-dessus. Cliquer sur le bouton "Submit design condition".
  • Voir le descriptif des colonnes en bas ("Column description").

 

Liens Internet et références bibliographiques

Animation : phénomène d'ARN interférents (revue "Nature")

The RNAi Web

Vidéo

RNAi Web

Quelques articles clés de l'interférence ARN

1. Napoli et al. (1990) "Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans" Plant Cell 2, 279 - 289

2. Lee et al. (1993) "The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14" Cell 75, 843 - 854

3. Fire et al. (1998) "Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans" Nature 391, 806 - 811

4. Montgomery, Xu & Fire (1998) "RNA as target of double-stranded RNA-mediated genetic interference in Caenorhabditis elegans" Proc. Natl Acad. Sci. 95, 15502 - 15507

5. Hamilton & Baulcombe (1999) "A species of small antisense RNA in post transcriptional gene silencing in plants" Science 286, 950 - 952

6. Elbashir et al. (2001) "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells" Nature 411, 494 - 498

 

Article 1

Article 2

Article 3

Article 4

Article 5

Article 6

 

Valid XHTML 1.0 Transitional         Flux RSS Retour haut de page