Corrections exercices de travaux dirigés de biologie cellulaire

 

Voir l'énoncé.

Exercice 13

13a. Si on dénombre les nucléotides d’un brin d’ADN, quelle est l'assertion correcte : A = C / A+G = C+T / A+T = G+T / A = 2C / A = 2T ?

Dans un brin d’ADN, les bases complémentaires sont en nombre égal : A = T et C = G ===> A+G = C+T

13b. Soit le brin d’ADN monocaténaire :         5’-TACGCCTAGCTTACGCAT-3’
Combien y a-t-il de liaisons phosphodiester dans le brin bicaténaire ?
Combien y a-t-il de liaisons hydrogène dans le brin bicaténaire ?

18 nucléotides dans la séquence donc 17 liaisons phosphodiester ===> 34 liaisons phosphodiester dans le brin bicaténaire

  • liaison A-T (adénine - thymine) = 2 liaisons H
  • liaison G-C (guanine - cytosine) = 3 liaisons H

===> (9x2) + (9x3) = 45 liaisons H

13c. Quelles sont les bases susceptibles de s’apparier dans le brin monocaténaire d’ARN suivant :         5’-AUGGAACGCCUUUACGUUC-3’
Combien y a-t-il de liaisons hydrogène dans le brin replié sur lui-même ?

Figure ci-contre : en rouge, les nucléotides susceptibles de former un double brin.

  • liaison A-U = 2 liaisons H
  • liaison G-C = 3 liaisons H

===> (2x2) + (3x3) = 13 liaisons H

 

ADN DNA brin complementaire codant transcrit ARN messager ARNm helix transcription brin monocatenaire bicatenaire phosphodiester biochimej polymerase uracile thymine base boucle

Retour en haut de page

 

13d. Soit la séquence d’ADN :         5’-CTACCCTGAGGTAATTGGCATC-3’
Quelle est la séquence du brin complémentaire après réplication ?
Quelle est la séquence de l’ARN après transcription en utilisant ce brin complémentaire comme brin sens ?


ADN A T G C
ARN A U G C

polymerase uracile thymine base boucle ADN DNA brin complementaire codant transcrit ARN messager ARNm helix transcription brin monocatenaire bicatenaire phosphodiester biochimej

Figure adaptée de : La transcription chez les eucaryotes (Université Paris VI - Jussieu)

Exemple : si le brin 1 est le brin non transcrit et le brin 2 est le brin transcrit (ou brin matrice), la séquence de l'ARN est équivalente à la séquence du brin 1 avec U qui remplace T :

brin 1 : 5'-ATGCGCTTGGATCGGTCATGTGCT-3'
brin 2 : 3'-TACGCGAACCTAGCCAGTACACGA-5'
ARN    : 5'-AUGCGCUUGGAUCGGUCAUGUGCU-3'


La séquence du brin complémentaire après réplication est :
brin ADN 5'-CTACCCTGAGGTAATTGGCATC-3'
brin complémentaire sens 3' - 5' 3'-GATGGGACTCCATTAACCGTAG-5'
brin complémentaire sens 5' - 3' 5'-GATGCCAATTACCTCAGGGTAG-3'
La séquence du brin d'ARN après transcription est :
brin sens (non transcrit) : sa séquence correspond à celle de l' ARN messager (à la différence T/U près) 5'-GATGCCAATTACCTCAGGGTAG-3'
ARN 5'-GAUGCCAAUUACCUCAGGGUAG-3'

Retour en haut de page

 

13e. Soit la séquence d’un fragment d’ADN :

5’-TTAATATGTGCTACTTCGAACACTGTCCCAAAGGTTAGTAATT-3’
3’-AATTATACACGATGAAGCTTGTGACAGGGTTTCCAATCATTAA-5’

Quelles sont les séquences des ARN qui pourraient être transcrits à partir de ce fragment d’ADN ?
Un seul ARN ainsi obtenu peut-être traduit. Pourquoi ?
Cet ARN qui peut-être traduit est l’ARN messager codant la vasopressine (une hormone). Quelle est la séquence de la vasopressine ?
La forme active biologiquement de la vasopressine est un nanopeptide avec Cys en N-terminal. Pourquoi ?

Transcription : 1er cas

Le brin d'ADN 5' ---> 3' est non transcrit : la séquence de l'ARN messager est équivalente à cette séquence avec U qui remplace T.

ADN 5' ---> 3' : 5’-TTAATATGTGCTACTTCGAACACTGTCCCAAAGGTTAGTAATT-3’
ARN 5' ---> 3' : 5’-UUAAUAUGUGCUACUUCGAACACUGUCCCAAAGGUUAGUAAUU-3’

Dans ce cas, le brin d'ADN 3' ---> 5' est transcrit : la séquence de l'ARN messager est la séquence complémentaire, orientée 5' ---> 3' avec U qui remplace T.

ADN 3' ---> 5' : 3’-AATTATACACGATGAAGCTTGTGACAGGGTTTCCAATCATTAA-5’
ARN 5' ---> 3' : 5’-UUAAUAUGUGCUACUUCGAACACUGUCCCAAAGGUUAGUAAUU-3’

Transcription : 2ème cas

Le brin d'ADN 5' ---> 3' est transcrit :

ADN 5' ---> 3' : 5’-TTAATATGTGCTACTTCGAACACTGTCCCAAAGGTTAGTAATT-3’
ARN 3' ---> 5' : 3’-AAUUAUACACGAUGAAGCUUGUGACAGGGUUUCCAAUCAUUAA-5’
ARN 5' ---> 3' : 5’-AAUUACUAACCUUUGGGACAGUGUUCGAAGUAGCACAUAUUAA-3’

Dans ce cas, le brin d'ADN 3' ---> 5' est non transcrit :

ADN 3' ---> 5' : 3’-AATTATACACGATGAAGCTTGTGACAGGGTTTCCAATCATTAA-5’
ARN 3' ---> 5' : 3’-AAUUAUACACGAUGAAGCUUGUGACAGGGUUUCCAAUCAUUAA-5’
ARN 5' ---> 3' : 5’-AAUUACUAACCUUUGGGACAGUGUUCGAAGUAGCACAUAUUAA-3’

Traduction

La traduction de l'ARN messager commence à un codon d'initiation AUG et se termine à un codon STOP (UAG, UGA, UAA). Ces codons ne sont présents que dans le brind'ARN issu de la transcription du brin d'ADN 3' ---> 5' :

ARN          : 5’- UU AAU AUG  UGC UAC UUC GAA CAC UGU CCC AAA GGU UAG UAA UU -3’
Vasopressine :            Met Cys Tyr Phe Glu His Cys Pro Lys Gly

Vasopressine (code à une lettre) : M C Y F E H C P K G

Vasopressine :

  • hormone peptidique synthétisée sous forme d'un précurseur (AVP : 164 acides aminés chez Homo sapiens) hydrolysé en 3 peptides : Arg-vasopressine, neurophysine 2 et copeptine.
  • il n'y a plus de Met N-terminale dans la forme mature de la vasopressine (9 acides aminés).
  • elle a un rôle anti-diurétique au niveau du rein : elle augmente la perméabilité à l'eau via l'insertion d'un canal aquaporine dans la membrane apicale.

Translate : exemple de logiciel (catégorie "Proteomics" - outils "Expasy") de traduction automatique de séquences ADN ou ARN dans les 6 phases de lecture possibles (3 phases sens 5' ---> 3' et 3 phases sens 3' ---> 5').

Coller les séquences ci-dessus pour obtenir les traductions "possibles". La phase de lecture correcte est "5'3' Frame 3":

  • Mode "verbeux" : N Met C Y F E H C P K G Stop Stop
  • Mode "avec nucléotides" : ttaatatgtgctacttcgaacactgtcccaaaggttagtaatt
                                 N  M  C  Y  F  E  H  C  P  K  G  -  -

Source de ces exercices

"Biologie cellulaire : exercices et méthodes" (2014) M. Thiry, S. Racano & P. Rigo - Editions DUNOD - ISBN : 978-2-10-070711-9

 

Valid XHTML 1.0 Transitional         Flux RSS Retour haut de page