Quelques méthodes d'analyse quantitative du transcriptome et de l'expression des gènes

(SAGE et ses dérivés - MPSS - CAGE - RNA-seq)

Sommaire
Tweet

1. Introduction

2. La méthode SAGE et ses dérivées (LongSAGE, SuperSAGE et DeepSAGE)

3. La banque de données SAGEmap et "Gene Expression Omnibus"

4. Les autres méthodes : MPSS, CAGE, RNA-seq

5. Liens Internet et références bibliographiques

 

1. Introduction

Les grands fragments d'ADN peuvent être analysés par séquençage complet, par séquençage à partir de l'une des deux extrémités ("single-end sequencing") ou par séquençage à partir des deux extrémités ("paired-end sequencing" - PET).

La méthode des EST a été la première à générer une étiquette pour chaque fragment de cDNA séquencé.

Structure gene

La méthode SAGE emploie une enzyme d'étiquetage (l'enzyme de restriction NlaIII qui coupe 13 pb en aval de son site de reconnaissance). Cette méthode génère des étiquettes de 13 pb de l'extrémité 3'.

Les méthodes LongSAGE et MPSS emploie l'enzyme de restriction MmeI qui coupe de 18 à 20 pb en aval de son site de reconnaissance et générent donc des étiquettes de 20 pb qui peuvent être beaucoup plus spécifiquement alignées / comparées avec des génomes dits de référence.

Les étiquettes issues des méthodes CAGE et 5′ LongSAGE sont obtenues à partir de l'extrémité 5′ des fragments de cDNA.

Les étiquettes issues de la méthode 3′ LongSAGE sont obtenues à partir de l'extrémité 3′ des fragments de cDNA.

La technologie PET ("paired-end tags") combine de manière covalente les étiquettes en 5′ et 3′ (20 - 30 pb chacune) d'un même fragment de cDNA en une seule double-étiquette.

Comparaison methodes

Source : Fullwood et al. (2009)

La méthode SAGE est présentée en premier car elle est l'une des plus anciennes. Cela permet de définir des termes, des principes, des démarches qui, à peu de choses près, sont identiques pour toutes les autres méthodes.

Ces dernières sont en général des affinements, et/ou s'appuient sur des technologies de séquençage à trés haut débit apparues récemment.

2. La méthode SAGE et ses dérivées (LongSAGE, SuperSAGE, DeepSAGE)

La méthode d'analyse sérielle de l'expression des gènes ou méthode SAGE permet une analyse de la fréquence d'expression d'un ARN messager parmi les milliers de produits dans une cellule, à un moment donné.

Elle se fonde sur l'analyse séquentielle d'un grand nombre de courts fragments d'ADNc, dont chacun représente la signature d'un gène.

C'est une méthode de choix pour l'analyse du transcriptome, car elle permet :

  • l'analyse de tous les transcrits (sauf ceux qui sont rares) sans sélection préalable de gènes connus, contrairement aux systèmes fondés sur l'hybridation à des collections de sondes nucléiques qui nécessitent que les gènes analysés soit préalablement caractérisés.
  • de découvrir de nouveaux gènes.
  • le dénombrement des ARN messagers. Elle permet donc la mesure quantitative du profil d'expression dans différentes conditions physiologiques.

La méthode SAGE diffère de l'approche par analyse d'EST car :

  • la taille des séquences analysées est minimale : en effet, une séquence d'ADNc de 10 nucléotides est une étiquette ("tag") de longueur suffisante pour identifier un ARN messager.
  • les étiquettes sont amplifiées par une méthode qui conserve les proportions relatives des ARN messagers.

Principe de la méthode SAGE

  • Une étiquette est une séquence spécifique de 10 à 20 nucléotides caractéristique d'un ARN messager.
  • Les étiquettes, isolées après digestion par des enzymes de restriction, sont liées bout à bout en une seule séquence (concatémère) qui est clonée, amplifiée par PCR.
  • Cette séquence unique est séquencée, révélant ainsi l'identité de chaque étiquette (et donc du géne dont l'ARN messager est issu).
  • En générant un grand nombre de séquences à partir d'un échantillon donné, il est possible de mesurer la fréquence des différentes étiquettes et avoir une idée du profil d'expression d'un grand nombre de gènes.
  • Cette technique nécessite des bases de données de séquences génomiques complètes.

étape 1

  • les ARNm sont rétro-transcrits en ADNc et biotinylés. Les ADNc biotinylés sont isolés à l'aide de billes sur lesquelles est gréffée la streptavidine.
  • Les ADNc subissent une hydrolyse par une première enzyme de restriction : Nla III ("anchoring enzyme"). Cette hydrolyse élimine environ 80% de la masse d'ADNc.
  • L'enzyme de restriction Nla III est spécifique du site 5'-CATG dont la fréquence est élevée (1/256). Ainsi, tous les fragments d'ADNc ont la même séquence CATG à l'extrémité 5'.
  • Remarque : l'enzyme Sau3A1 spécifique du site GATC est parfois utilisée. L'enzyme RsaI aussi.

Source : SAGE -"Science Park"

Etape 1 methode SAGE

L'un des points originaux de la méthode SAGE est de dupliquer l'ensemble de ces opérations (2 prélèvements disctincts du même échantillon d'ARN messagers de départ).

Le but de cette duplication est de traiter chaque échantillon avec 1 adaptateur particulier.

étape 2

Etape 2 methode SAGE

étape 3

Etape 3 methode SAGE

étape 2
  • Pour un prélèvement : ligation de l'adaptateur ("linker") A à l'extrémité CATG.
  • Pour l'autre prélèvement : ligation de l'adaptateur B à l'extrémité CATG.
  • Ces adaptateurs contiennent :
    1. des sites de fixation uniques pour les amorces
    2. la séquence de reconnaissance (5'-GGGAC) pour l'enzyme d'étiquetage ("tagging enzyme") BsmF I
    3. une extrémité compatible avec l'enzyme de restriction Nla III

étape 3

  • Digestion par l'enzyme d'étiquetage BsmF I : cette enzyme génère les étiquettes en coupant les ADNc 10 nucléotides en 3' de sa séquence de reconnaissance.
  • Les fragments d'ADNc sont libérés des billes magnétiques et la séquence d'étiquetage est ajoutée aux adaptateurs.
  • les fragments d'ADNc (libérés des billes magnétiques) portent tous la séquence de l'adaptateur à leur extrémité 5'.

En revanche, ils diffèrent tous à leur extrémité 3' par les 10 à 14 nucléotides spécifiques de leur étiquette.

étape 4

  • Ligation des étiquettes par leur extrémité 3' : on obtient des étiquettes doubles ("ditags").
  • Les étiquettes doubles sont amplifiées par PCR avec 2 amorces : l'une spécifique de l'adaptateur A, l'autre de l'adaptateur B.

étape 5

  • Digestion avec l'enzyme de restriction Nla III qui libère les adaptateurs, puis isolement des étiquettes doubles.
  • L'étape suivante est la concaténation des étiquettes doubles (jusqu'à une cinquantaine)
  • Les concatémères sont clonés.

Source : SAGE - "Science Park"

étape 4

Etape 4 methode SAGE

étape 5

Etape 5 methode SAGE

étape 6

  • Les étiquettes sont séquençées.
  • Comme elles sont liées 2 à 2 en orientation inverse dans les étiquettes doubles, il faut séquencer les 2 brins des ADNc.
  • Chaque concatémère est unique car la concaténation est aléatoire.
  • La taille des concatémères conditionne la quantité d'information portée par chaque clone.

Exemple de concatémères

CATGACCCACGAGCAGGGTACGATGATCATGGAAACCTATGCACCTTGGGTAGCACATG

CATG - étiquette 1 - étiquette 2 - CATG - étiquette 3 - étiquette 4 - CATG

L'analyse bioinformatique des données est effectuée avec des logiciels spécifiques.

Schématiquement, ceux-ci :

  • détectent la séquence "CATG" au début de chaque étiquette
  • décryptent les 10 nucléotides qui suivent cette séquence
  • en dénombrent l'occurrence

Le dénombrement des ARN messagers permet la mesure quantitative du profil d'expression dans différentes conditions physiologiques.

Comptage des etiquettes SAGE

Résultat

Resultat

La comparaison avec des banques de données de séquences de génomes complets permet d'identifier les gènes mis en évidence.

étiquette    	Nombre      Nom du gène

ATATTGTCAA   	5       	translation elongation factor 1 gamma
AAATCGGAAT   	2       	T-complex protein 1, z-subunit
ACCGCCTTCG   	1       	no match
GCCTTGTTTA   	81      	rpa1 mRNA fragment for r ribosomal protein
GTTAACCATC   	45      	ubiquitin 52-AA extension protein
CCGCCGTGGG   	9       	SF1 protein (SF1 gene)
TTTTTGTTAA   	99 	        NADH dehydrogenase 3 (ND3) gene
GCAAAACCGG   	63      	rpL21
GGAGCCCGCC   	45      	ribosomal protein L18a
GCCCGCAACA   	34      	ribosomal protein S31
GCCGAAGTTG   	50 	        ribosomal protein S5 homolog (M(1)15D)
TAACGACCGC   	4 	        BcDNA.GM12270

La méthode LongSAGE est une adaptation de la méthode SAGE.

Elle génère des étiquettes plus longues de 14 à 18 paires de base et un site de restriction pour l'endonuclease MmeI.

Source : Saha et al. (2002)

methode LongSAGE

Plus récemment encore la méthode SuperSAGE a été développée (Matsumura et al., 2003).

Elle génère des étiquettes encore plus longues de 26 paires de base et un site de restriction pour l'endonuclease Ecop15I (endonucléase du phage P1).

La figure ci-contre montre l'intérêt d'étiquettes plus longues : les 18 premières bases ne permettent pas de discriminer.

Les étiquettes de de 26 paires de base sont 17.000 fois plus spécifiques que des étiquettes de 18 paires de base.

Longueur etiquette LongSAGE

Source : Genxpro

Avantages de cette méthode :

  • l'annotation des génomes est encore plus précise.
  • les profils d'expression extrèmement précis sont obtenus. Des transcrits issus de l'épissage alternatif peuvent être identifiés.
  • les étiquettes sont suffisamment longues pour être déposées sur des puces à ADN.
  • plus récente, elle bénéficie des nouvelles techniques de séquençage massivement parallèle (des centaines de millions d'étiquettes peuvent être analysées).
  • elle permet l'étude simultanée de deux organismes interagissant (exemple : hôte - pathogène).

Enfin, la méthode DeepSAGE combine :

  • les étapes initiales de la méthode LongSAGE (les étapes de clonage sont éliminées)
  • le séquençage par la technologie à émulsion 454

300.000 étiquettes sont ainsi générées en une seule analyse !

3. La banque de données "SAGEmap" et "Gene Expression Omnibus"

a. "SAGEmap" (NCBI) - (autre lien)

Elle permet d'établir une relation entre des étiquettes SAGE ou des étiquettes LongSAGE (17 nucléotides) et les groupes ("clusters") "UniGene".

Ces groupes contiennent des séquences qui représentent un gène unique (voir : Arabidopsis thaliana : UniGene Build #72).

"SAGEmap" contient plusieurs centaines d'expériences SAGE (banques d'ADNc dans différentes conditions).

b. Gene Expression Omnibus (GEO)

C'est une base de données d'expression et d'abondance de molécules (ARNm, ADN génomique et protéines) et aussi un système de recherche de ces données d'expression. Les données soumises répondent à la charte de standardisation "MIAME".

Les données de GEO sont issues de diverses technologies : puces à ADN, méthode SAGE et spectromètrie de masse.

Retour haut de page

 

5. Les autres méthodes

a. La méthode "Massively parallel signature sequencing" - MPSS - Brenner et al. (2000)

Méthode liée à l'apparition des technologies de séquençage à trés haut débit qui ont révolutionné la portée et l'ampleur des études en génomique.

Elle génère des étiquettes de 16 à 20 pb (en moyenne 17 pb).

Cette identification est effectuée en parallèle sur des centaines de milliers de billes et environ 1 million de signatures sont obtenues par expérience.

Voir une animation décrivant cette technique.

Avantages de cette technique :

  • détection de quasiment tous les génes exprimés dans un tissus, même ceux dont le niveau d'expression est faible
  • détection de "petits" ARN ("small RNAs" : snRNA, snoRNA, siRNA ("small interfering RNA"), miRNA, piRNA, ...) de faible taille (20 - 30 nucléotides)
  • mesure précise de ce niveau d'expression via un comptage précis et non biaisé des ARN messagers d'un tissus

Petits ARN - small RNAs

Source : Buckingham S. (2003)

Application à Arabidopsis

Remarque : une étude récente (Yamamoto et al., 2009) combinant la méthode "Cap-trapper" (Carninci et al., 1996) qui permet de sélectionner des transcrits entiers et la méthode MPSS a analysé en détail les promoteurs de Arabidopsis.

b. La méthode CAGE

La méthode CAGE ("Cap analysis gene expression") est basée sur la méthode "Cap-trapper" (Carninci et al., 1996) qui permet de sélectionner des transcrits entiers ("full-length RNAs") qui contiennent donc entièrement leur extrémité 5'. Les ARNr et les ARNt ne sont pas retenus.

Il s'ensuit un marquage à l'extrémité 5' qui introduit un site de reconnaissance d'une enzyme de restriction (MmeI).

La suite de la méthode CAGE n'est autre que la méthode LongSAGE pour générer les étiquettes CAGE.

La méthode CAGE produit donc des étiquettes (environ 20-21 pb) à partir du tout début de l'extrémité 5' des ARNm ("5' ends of capped transcripts").

Cap analysis gene expression

Source : Shiraki et al. (2003)

Les étiquettes CAGE ont pour but de localiser avec exactitude les sites de démarrage de la transcription dans le genome.

Cette méthode permet d'étudier la stucture des régions promotrices.

Ces régions peuvent être identifiées en comparant des séquences génomiques relativement distantes sur le plan évolutionnaire, en focalisant sur les régions conservées en amont des gènes annotés.

Structure coiffe

Une version simplifiée de la méthode CAGE a été développée : le premier brin synthétisé d'ADNc est séquencé par la technologie de séquençage à trés haut débit HeliScope.

Elle s'affranchit donc de la synthèse du second brin d'ADNc, de l'amplification, de la ligation / digestion.

Base de données : "CAGE homepage at the RIKEN Omics Science Center"

c. Méthode "RNA-seq" ou "Whole Transcriptome Shotgun Sequencing" - WTSS

C'est une méthode récente (protocole général ci-dessous). De nombreuses adaptations de certaines des étapes ont trés vite été développées.

Elle est aussi liée à l'apparition des technologies de séquençage à trés haut débit.

Des millions de fragments ("ultra high-throughput short reads") sont générés et séquencés.

RnaSEQ - Whole Transcriptome Shotgun Sequencing

Source : Nagalakshmi et al. (2008)

Principales étapes (ci-contre) :

  • sélection d'une population d'ARN poly(A)+ (totaux ou fractionés)
  • séquençage à partir de l'une des deux extrémités ("single-end sequencing") ou par séquençage à partir des deux extrémités ("paired-end sequencing" - PET)
  • comparaison / alignements des millions de courts segments séquencés avec des génomes entiers

Source : Wang et al. (2009)

protocole RNA seq

Quelques avantages de la méthode "RNA-seq" ("RNA-sequencing")

  • Un procole simplifié de construction des banques.
  • Résolution à la base près : les fragments séquencés sont trés courts (quelques dizaines de nucléotides), leur nombre est énorme (plusieurs millions !) et ils se chevauchent. Elle permet donc (entre autres) :
    1. l'analyse de régions ayant de fortes homologies (séquences répétées par exemple), de SNP.
    2. l'analyse des bordures exoniques, des profils d'épissage alternatif et l'étude d'isoformes de protéines (voir "Les frontières intron-exon" ci-dessous).
    3. la découverte de "petits" ARN ("small RNAs" : snRNA, snoRNA, siRNA, miRNA, piRNA ("Piwi-interacting RNAs"), ...) de faible taille (20 - 30 nucléotides) et prédiction de leur structures secondaires.
  • Extrême sensibilité ("dynamic range of expression") : 10 à 100 fois plus élevé que les puces à ADN permet une quantification des ARN et la détection d'ARN rares. Elle permet de mettre en évidence des régions dont on ne savait pas au préalable qu'elles sont transcrites.
  • Informations issues de la comparaison avec des génomes complets :
    1. Il n'est pas nécessaire d'avoir des connaissances sur le génome étudié. Cependant, si l'on dispose de génomes de "référence", c'est une méthode de choix pour améliorer sensiblement leur annotation.
    2. Dans les régions non traduites en 5' ("5′ UTRs"), il existe des phases de lecture ouverte dites en amont du codon d'initiation ("upstream ORFs - uORFs") qui régulent l'expression des gènes codant des protéines et la dégradation des ARMm.
    3. Localisation du site de polyadénylation de chaque transcrit, l'étiquette étant générée à partir d'un fragment issu d'un site de restriction (de 4 pb) situé immédiatement en 5' du site poly-A+.
    4. Différentes étiquettes homologues de différentes séquences d'un même gène mettent en évidence des terminaisons alternatives en 3'.
  • On peut étudier l'expression différentielle de transcrits par comparaison des résultats obtenus avec des banques issues de différents tissus et/ou traitements.

Les frontières intron-exon ("exon-intron borders")

La plupart des introns commencent par la séquence consensus GU et finissent par la séquence consensus AG (sens 5' vers 3'). Ces séquences sont appelés respectivement "site donneur lors de l'épissage" et "site accepteur lors de l'épissage" ("splice donor site" et "splice acceptor site").

Il existe en général une région riche en nucléotides pyrimidiques (C et U) en amont du site AG.

En amont de cette région se trouve le "point de branchement" ("branch point") qui contient toujours une adénine, mais qui par ailleurs est faiblement conservée.

Une séquence typique est YNYYRAY où Y est une pyrimidine (C ou U), N n'importe quel nucléotide, R est une purine (G ou A) et A est l'adenine.

Dans 60% des cas, l'extrémité de la séquence de l'exon situé en 5' (site donneur) est (A/C)AG et l'extrémité de la séquence de l'exon situé en 3' (site accepteur) est G (voire A).

Sequences consensus frontiere intron exon border

Source : "RNA sequence analysis tools"

L'analyse du transcriptome de la levure prédit l'existence de telles ORF pour 6% des transcrits, en particulier en ce qui concerne les gènes codant des protéines se fixant à l'ADN.

Dans la figure A ci-dessous, on notera l'échelle trés précise sur le chromosome II.

Cette étude a porté également sur la transcription dans les régions intergéniques en identifiant des segments d'au moins 150 pb avec un taux d'expression significativement supérieur aux segments environnants.

204 segments de ce type (non observés par la technologie des puces à ADN) ont ainsi été mis en évidence.

methode Rnaseq  recherche ORF

Source : Nagalakshmi et al. (2008)

De nombreuses variantes de la méthode "RNA-seq" d'origine ont été développées pour étudier telle ou telle partie du génome via le transcriptome.

La figure ci-dessous en montre un exemple :

(a) Fragmentation des ARN messagers.

(b) Synthèse du premier brin de cDNA avec une amorce hexamère aléatoire marqué par une séquence flanquante (FDV).

(c) Des cytosines sont ajoutées à chaque cDNA.

(d) Une hybridation entre le cDNA (vert) et un fragment d'ARN marqué par une seconde séquence flanquante (RDV) permet d'incorporer un site de marquage RDV dans le premier brin de cDNA.

(e) La banque est amplifiée par PCR avec des amorces FDV et RDV.

(f) Les fragments amplifiés sont attachés à des billes (pour le séquençage à suivre) par émulsion.

(g) Les billes sont covalamment fixées à un support.

Application methode RNA seq

Source : Cloonan et al. (2008)

De courtes séquences (25 à 35 nucléotides) sont générées via la technologie "SOLID" ("Sequencing by Oligonucleotide Ligation and Detection") : le séquençage est basé sur l'amplification par émulsion et l'hybridation-ligature chimique. Il utilise une ligation avec une DNA ligase.

Voir un développement de cette technique et du principe des réactions chimiques.

d. Moyens bioinformatiques pour ces types de méthodes

En parallèle de ces technologies massivement productives de courts fragments séquencés ("ultra high-throughput short reads") ont été développés :

  • de nouveaux algorithmes pour l'alignement de ces millions de courts segments séquencés avec des génomes entiers ("alignement du transcriptome"). Exemple : Cufflinks permet l'assemblage des transcrits, le calcul de leur abondance, l'analyse de l'expression différentielle (différentes conditions), l'analyse de la régulation de l'expression.
  • des site web avec des applications de visualisation ("mapper") et d'annotation. Exemple : TopHat : "a fast splice junction mapper for RNA-Seq reads".

Autres exemples de programmes

  • SOAP : "Short Oligonucleotide Alignment Program"
  • RMAP
  • MAQ : "Mapping and Assembly with Qualities"
  • ELAND : "Efficient Large-Scale Alignment of Nucleotide Databases"

 

5. Liens Internet et références bibliographiques

Fullwood et al. (2009) "Next-generation DNA sequencing of paired-end tags (PET) for transcriptome and genome analyses" Genome Res. 19, 521 - 532

Article

Méthode SAGE d'origine : Velculescu et al. (1995) "Serial analysis of gene expression" Science 270, 484 - 487

Description de modifications du protocole initial de la méthode SAGE

SageNet

Lash et al. (2000) "SAGEmap : a public gene expression resource" Genome Res. 7, 1051 - 1060

Bases de données SAGEmap et MAP Viewer (NCBI)

SAGEmap

Barrett et al. (2005) "NCBI GEO : mining millions of expression profiles : database and tools" Nucleic Acids Res. 33, D562 - D566

GEO ("Gene Expression Omnibus")

GEO

Saha et al. (2002) "Using the transcriptome to annotate the genome" Nature Biotechnol. 20, 508 - 512

Méthode SuperSAGE : Matsumura et al. (2003) "Gene expression analysis of plant host-pathogen interactions by SuperSAGE" Proc. Natl. Acad. Sci. USA 100, 15718 - 15723

Méthode DeepSAGE : Nielsen et al. (2006) "DeepSAGE -- digital transcriptomics with high sensitivity, simple experimental protocol and multiplexing of samples" Nucleic Acids Res. 34, e133

Article

Article

Article

Méthode MPSS : Brenner et al. (2000) "Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays" Nat.Biotechnol. 18, 630-634 Article
Méthode CAGE : Shiraki et al. (2003) "Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage" Proc Natl Acad Sci U S A 100, 15776 - 15781 Article

Méthode RNA-Seq

Nagalakshmi et al. (2008) "The Transcriptional Landscape of the Yeast Genome Defined by RNA Sequencing" Science 320, 1344 - 1349

Cloonan et al. (2008) "Stem cell transcriptome profiling via massive-scale mRNA sequencing" Nature Methods 5, 613 - 619

Site web de la firme "Illumina"

Article

Article

Illumina

Trapnell et al. (2009) "TopHat: Discovering splice junctions with RNA-Seq" Bioinformatics 25, 1105 - 1111

SOAP: Li et al. (2008) "SOAP: short oligonucleotide alignment program" Bioinformatics 24, 713 - 714

RMAP : Smith et al. (2008) "Using quality scores and longer reads improves accuracy of Solexa read mapping" BMC Bioinformatics 9, 128

MAQ : Li et al. (2008) "Mapping short DNA sequencing reads and calling variants using mapping quality scores" Genome Res.

 

Valid XHTML 1.0 Transitional         Flux RSS Retour haut de page