Déshydrogénases et pli Rossmann / calmoduline et motif "EF-hand" / récepteur de l'insuline / siRNA
biochimej Flux RSS

Chargement de la page : "Déshydrogénases et pli Rossmann / calmoduline et motif "EF-hand" / récepteur et insuline / siRNA"
A. Etude du pli Rossmann des déshydrogénase à NAD(P)+

1. Aller au NCBI. Rechercher les séquences protéiques de la lactate déshydrogénase. Attention : anglais, abréviation, emploi des opérateurs logiques (Booléens) : "AND", "OR" et "NOT".

Avec l'option "Advanced" (lien en haut de la page), affiner la recherche avec EC 1.1.1.27 et Arabidopsis thaliana dans les résultats précédents :

"#1 AND in builder" puis taper "1.1.1.27" avec le champs "EC/RN Number" du menu déroulant.
"#2 AND in builder" puis taper "Arabidopsis thaliana" avec le champs "Organism" du menu déroulant.

Enregistrer la séquence au format FASTA du fichier AAC02678.

≈ 131.000 résultats

 

1 séquence : AAC02678

Comment sait-on qu'il s'agit d'une enzyme ?

Quelle réaction catalyse-t-elle ?

Dans quelle voie métabolique ?

Remarques

En quoi le fichier de numéro d'accession AAN87112 est-il "abusif" ?
En quoi n'est-il cependant pas "erroné" ?

Retour haut de page

2. Ouvrir le fichier GenPept AAC02678. Examiner les informations des différents champs.

Ouvrir l'onglet "Graphics" (en haut). Examiner la partie "site Features - CDD"

  • Quelles sont les positions des acides aminés du site de fixation du NAD+ ?
  • Quelles sont les positions des acides aminés du site de fixation du substrat ?

Que remarque-ton ?

Pourquoi les acides aminés de chacun de ces sites ne sont-ils pas contigus dans la séquence ?

Acides aminés du site de fixation du NAD+ :

  • Positions 72, 74, 77, [115 - 119], 156, 158, 181, 185, 213, 268 et 272
  • En particulier : ... VT115AGAR119Q ...

Acides aminés du site de fixation du substrat :

  • Positions 120, 126, 158, 189, 213, 258 et 268.
  • En particulier : RQ120N ... SR126L ... SN158P [.....] YT268S

On remarque que les acides aminés N158, H213 et T268 sont communs aux 2 sites de fixation : ils établissent donc des liaisons avec la molécule de coenzyme et la molécule de substrat.

Chacun des sites de fixation résultent du regroupement d'acides aminés dans l'espace via le repliement de la chaîne polypeptidique et la formation de domaines indépendants.

Retour haut de page

3. Cliquer sur le lien suivant : /db_xref="CDD:133429.

  • A quelle super-famille de protéines appartient la lactate déshydrogénase ?
  • Les déshydrogénases en général appartiennent-elles à la même super-famille de protéines ?
  • "NAD(P)-binding Rossmann fold superfamily"
  • Oui
Examiner l'alignement automatique généré en bas de la page "Conserved Protein Domain Family - LDH_1".
Repérer un motif GXGXXG dans la partie N-terminale des séquences.

Quelles sont les particularités physico-chimiques de la glycine ?

  • Acide aminé peu encombrant : l'atome H constitue la plus petite chaîne latérale.
  • Caractère polaire : possibilité de formation de liaisons hydrogènes.

Ces caractéristiques permettent une certaine fléxibilité de la chaîne polypeptidique : la glycine est souvent dans des portions de séquence d'acides aminés qui forment des boucles.

Aller à Interpro. Rechercher "lactate dehydrogenase nad+ Arabidopsis".

Pourquoi obtient-on autant de résultats ?
A quoi correspondent les informations de la colonne "Source database" ?

Il n'y a pas de résultats que pour la lactate déshydrogénase.

A certaines des bases de données constitutives du consortium Interpro.

Retour haut de page

4. Rechercher dans la base de données Uniprot le fichier correspondant au fichier GenPept obtenu au NCBI.

  • Quel est le numéro d'accession du fichier Uniprot ?
  • Quelles informations suplémentaires obtient-on ?

Numéro d'accession : O49191 (O49191_ARATH)

Un trés grand nombre d'informations supplémentaires. Notamment :

  • La réaction enzymatique, la localisation subcellulaire et de trés nombreux liens vers diverses bases de données (InterPro, NCBI , PDB, ...).
  • L'ontologie et notamment l'annotation du gène codant la lactate déshydrogénase dans la base de données TAIR (dédiée à Arabidopsis thaliana) : "Lactate/malate dehydrogenase family protein" & locus AT4G17260.

A quelle protéine correspond le fichier GenPept ABI54333 ?

Vérifier avec le programme d'alignement de séquences MULTALIN si les séquences des fichiers AAC02678, O49191 et ABI54333 sont identiques (dans ce cas les valeurs du paramètre "check" au dessus de l'alignement obtenu sont identiques).

Pourquoi le fichier ABI54333 n'est-il pas renvoyé dans la requête d'origine au NCBI ?

ABI54333 : lactate déshydrogénase de Arabidopsis thaliana.

  • Les séquences AAC02678 et O49191 sont identiques.
  • Les séquences AAC02678 et ABI54333 diffèrent de 1 acide aminé : V155 => I155 (différence conservative).

Le champs "DEFINITION" du fichier GenPept ABI54333 contient "At4g17260 [Arabidopsis thaliana]" et non "lactate dehydrogenase".

Retour haut de page

5. Aller à ScanProsite. Entrer la séquence FASTA de la lactate déshydrogénase AAC02678 et lancer le scan.

Dans la page de résultat, trouver le lien vers le motif consensus ("consensus pattern") du site actif des lactate déshydrogénases.
Quelle est l'expression régulière (au format prosite) de ce motif ?

Lien vers le motif : PS00064

[LIVMA]-G-[EQ]-H-G-[DN]-[ST]

Retour haut de page

6. Aller à PHI-BLAST au NCBI.

  • Fenêtre "Enter Query Sequence" : entrer la séquence FASTA de AAC02678.
  • Champs "Organism" : sélectionner Homo sapiens en tapant les premières lettres dans le un menu déroulant qui s'ouvre=> taxid:9606 (attention à la faute d'orthographe dans le menu déroulant).
  • Sélectionner l'algorithme PHI-BLAST : une petite fenêtre s'ouvre => entrer l'expression régulière du motif consensus (ci-dessus).
  • Ouvrir l'item "Algorithm parameters" : sélectionner 50 séquences (menu "Max target sequences").
  • Lancer PHI-BLAST pour effectuer la recherche homologues et/ou similaires de la lactate déshydrogénase de l'homme.

Récupérez les séquences FASTA de 10 à 20 résultats caractérisés par des E-value faibles mais sensiblement différentes les unes des autres : menu déroulant "Download" (au dessus de la liste des résultats), sélectionner "FASTA (complete sequence)" => un fichier texte est créé.

Voir un descriptif de BLAST.

Retour haut de page

7. Avec MULTALIN, alignez la séquence de la lactate déshydrogénase de Arabidopsis thaliana avec les séquences FASTA de Homo sapiens issues de PHI-BLAST.

  • Le but est de mettre en exergue un motif G-X-G-X-X-G du côté N-terminal des séquences : il faut donc "jouer" sur le choix de la matrice (exemple : Dayhoff), des valeurs de gap (exemple : 6 - 0) et éliminer les séquences trop longues ou trop courtes (exemples : NP_001158886, XP_005252862, XP_016873210 ...) sauf celle de Arabidopsis thaliana.
  • Ecrire l'expression régulière la plus précise de ce motif qui tient compte de toutes les séquences conservées.

Retour haut de page

8. Illustration : structure du domaine liant le NAD(P)+ - le pli Rossmann

  • Récupérer la séquence de la lactate déshydrogénase de Squalus acanthias : Uniprot P00341.
  • Refaire l'alignement MULTALIN en y ajoutant cette séquence : repérer le motif spécifique de la lactate déshydrogénase de Squalus acanthias (GVGAVG).

Voir les spécificités du pli rossmann des déshydrogénases à NAD(P)+ pour la suite.

a. Visualisation de la lactate déshydrogénase de Squalus acanthias à une résolution de 3 Å

Code PDB : 3LDH

Le pli Rossmann ("Rossmann fold" - en hommage à Michael Rossmann) est une structure super-secondaire (assemblage de plusieurs types de structures secondaires) composée de 3 feuillets β liés à 2 hélices α de manière alternée (β-α-β-α-β).

Un pli Rossmann peut fixer 1 nucléotide.

Donc le domaine de fixation d'un dinucléotides (tel que NAD+ ou NADP+) contient 2 plis Rossmann appariés, chacun d'eux fixant l'un des nucléotides du co-facteur.


b. Prédiction de la structure secondaire

Le motif consensus GXGXXG riche en glycine forme une boucle ("glycine-rich P-loop motif") qui effectue un tour serré entre la fin du premier feuillet β (β7) et le début de l'hélice de fixation du dinucléotide (α6) au sein du pli Rossmann.

Effectuer une prédiction de la structure secondaire de la séquence de lactate déshydrogénase de Arabidopsis thaliana.

Repérer les acides aminés du Pli Rossmann :

  • Sont-ils prédits dans une structure secondaire correcte ?
  • Et les acides aminés du motif GXGXXG ?

a. Prédiction de la structure secondaire avec HHpred.

b. Exemples d'autres logiciels : Jpred - CFSSP - GOR

(Etre patient pour les résultats).

Retour haut de page

9. Recherche d'annotation de fonctions de la lactate déshydrogénase via l'ontologie

Rappels

  • Il ne sert quasiment à rien de disposer de milliards de séquences (nucléotidiques - ADN, ARN divers - et peptidiques) si on ne sait pas à quelle(s) molécule(s) ces séquences correspondent, ni quelle est la fonction de ces molécules et dans quel compartiment de la cellule elles fonctionnent, ni avec quel(s) partenaire(s) elles interagissent.
  • Cet ensemble d'informations qui constituent la carte d'identité complète et non ambigü de chaque molécule et de chaque processus biologique est l'ultime élément clé de la biologie moderne : l'annotation qui utilise des relations sémantiques et de subsomption afin de construire une ontologie (au sens informatique du terme).

La principale base de données mondiale est la base de données Gene Ontology (GO).

Les termes GO sont les noeuds de l'ontologie :

  • Le produit d'un gène est adressé à un ou plusieurs compartiments cellulaires : termes GO "Cellular Component" (CC)
  • Le produit d'un gène participe à un ou plusieurs processus biologiques : termes GO "Biological Process" (BP)
  • Le produit d'un gène y remplit une ou plusieurs fonctions moléculaires : termes GO "Molecular Function" (MF)

Voir un cours sur l'annotation et l'ontologie.

Retour haut de page

Aller à "Gene Ontology" (GO). Rechercher "lactate dehydrogenase arabidopsis" dans le champs "Search GO terms or Gene Product in Amigo ...".

  • Dans la page qui s'ouvre, cliquer sur le bouton bleu "Genes and gene products".
  • Dans la page qui s'ouvre : colonne "Gene/product" => cliquer sur le lien AT4G17260 (tout en bas).
  • Dans la page de résultats : 1ère ligne - colonne "GO class (direct)" => cliquer sur le lien "carbohydrate metabolic process" (numéro d'accession GO:0005975).

Ouvrir l'onglet : "Inferred Tree View".

  • Cliquer sur le terme GO:0016052 carbohydrate catabolic process
  • Puis cliquer sur le terme GO:0043470 regulation of carbohydrate catabolic process
  • Puis cliquer sur le terme GO:1904023 regulation of glucose catabolic process to lactate via pyruvate

Ouvrir l'onglet "Graph View" et examiner :

Interpréter les liens relationnels.

Retour haut de page

B. Etude des sites de fixation du calcium de la calmoduline (CaM)

1. Exemple de motif dans la syntaxe PROSITE :

<A-x-[ST](2)-x(0,1)-{V}

Ce motif se lit : "Ala en position N-terminale puis n'importe quel acide aminé puis 2 fois (Ser ou Thr) puis aucun acide aminé ou n'importe quel acide aminé puis n'importe quel acide aminé sauf Val."
Ecrire le motif suivant dans la syntaxe PROSITE :
"4 Ser puis (Asp ou Ser) puis n'importe quel acide aminé puis (Asp ou Glu) puis (Glu ou Gly ou Val) puis 1 à 7 fois n'importe quel acide aminé puis (Glu ou Gly) puis 1 à 2 fois n'importe quel acide aminé puis 4 fois (Arg ou Lys)."

S(4)-[DS]-x-[DE]-[EGV]-x(1,7)-[EG]-x(1,2)-[KR](4)

Exemple : SSSSSDDEEEEKRKR

Retour haut de page

Le motif de fixation du calcium de la calmoduline s'appelle motif "EF-hand" composé d'environ 30 acides aminés :

  • Ce motif contient 2 hélices α notées E et F (figurées respectivement par l'index et le pouce d'une main - figure ci-contre), reliées par une boucle.
  • Lors de la fixation du calcium, l'hélice F passe d'une conformation "fermée" (apo-CaM) à une conformation "ouverte" (holo-CaM).

La calmoduline fixe 4 atomes de calcium :

  • Chacune des 4 boucles de liaison au calcium est inclue dans un motif "EF-hand" et ont des séquences homologues.
  • La syntaxe PROSITE du motif consensus de ces séquences est : [DN]-x-D-G-[DN]-G-[TYQ]-x(4)-E

helice helix motif EF hand calmodulin CaM

Source : PFAM (PF00036)

Quelles sont les propriétés physico-chimiques des acides aminés de ce motif consensus ?

Pourquoi ?

  • Acides aminés acides (D et E) ou déprotonable (Y) donc chargés moins au pH cellulaire.
  • Acides aminés polaires (G, N, Q, T et Y à pH 7) donc susceptibles d'établir des liaisons hydrogène ou électrostatiques.

Ces propriétés physico-chimiques permettent la fixation de Ca2+ (cation divalent).

Retour haut de page

2. Aller au NCBI. Effectuer une recherche des séquences de la calmoduline de Homo sapiens. Outil "Advanced", requête : (calmodulin[Protein Name]) AND homo sapiens[Organism] => 8 fichiers.

Ouvrir le fichier GenPept CAA36839. Ouvrir l'onglet "Graphics".

Ligne "site Features - CDD" - "Ca2+ binding site" :

  • Repérer les acides aminés constitutifs des 2 motifs "EF-hand" en laissant la souris sur les liens "Efh".
  • Quelles sont les positions des acides aminés du 1er motif "EF-hand" qui fixent le Ca2+ ?
  • Retrouve-t-on le motif PROSITE ci-dessus ?

Acides aminés des motifs EFh :

  • 1er motif : 12 - 77
  • 2nd motif : 88 - 150

Acides aminés du 1er motif EFh qui fixent le Ca2+ :

  • Positions 21, 23, 25, 32, 57, 59, 64 et 71.
  • FD21KD23GD25G ... KE32L ... VD57AD59D ... GN64G ... PE71F

La séquence FD21KD23GD25G ... KE32 répond à l'expression régulière du motif PROSITE.


Visualisation de la calmoduline de l'homme (non complexée au calcium) à une résolution de 1,7 Å

Code PDB : 1CLL

Coordination et acides aminés du motif "EF - hand" EF1 :

X = D21; Y = D23; Z = D25; -X = H2O; -Y = T27; -Z1 = E3; -Z2 = E32

Retour haut de page

3. Aller à ScanProsite.

  • Rechercher le motif consensus de fixation du calcium (motif "EF-hand") en utilisant l'expression régulière [DN]-x-D-G-[DN]-G-[TYQ]-x(4)-E.
  • Choisir la bonne option de recherche.

Analyser le résultat (exemples : "polymerase processivity factor component A20", "Calcium-binding allergen Bet v3", "Calbindin", ...)

Repérer le résultat P0DP23 (CALM1_HUMAN) : retrouve-t-on le motif recherché ?

Consulter le fichier PROSITE du motif "EF-hand" : PS00018

  • Récupérer le motif complet (attention au retour à la ligne / le point final n'en fait pas partie).
  • Recommencer ScanProsite avec ce motif. Limiter le nombre de résultats à 1000 (option "Maximum number of displayed matches").

Pourquoi le résultat est-il étonnant ?

Motif complet : D-{W}-[DNS]-{ILVFYW}-[DENSTG]-[DNQGHRK]-{GP}-[LIVMC]-[DENQSTAGC]-x(2)-[DE]-[LIVMFYW]

Résultat : de très nombreuses protéines / enzymes qui ne fixent pas le calcium ont une séquence qui répond à ce motif PROSITE.

Retour haut de page

4. Emettre une hypothèse pour expliquer que la calmoduline reconnait autant de cibles distinctes bien qu’il y ait une très forte homologie de séquence en acides aminés entre les calmodulines.

Retour haut de page

C. Etude du récepteur de l'insuline

a. Aller au NCBI. Effectuer une recherche de récepteur de l'insuline de l'homme.

  • Quels mots-clés est-il judicieux d'employer ?
  • Pourquoi obtient-on autant de résultats ?

Exemple : (insulin receptor[Protein Name]) AND Homo sapiens[Organism]

On obtient beaucoup de fichiers correspondant :

  • à une séquence incomplète ("partial")
  • à des molécules en relation avec le récepteur de l'insuline

Avec les fonctionalités de "Advanced", récupérer le sous-ensemble de fichiers qui ne contiennent pas le mot "partial".

Combien de fichier(s) obtient-on ?

Le fichier AAA59452 est intéressant.

  • Pourquoi n'est-il pas renvoyé ?
  • Elimine-t-on ce fichier avec le filtre précédent ?

Réfléchir à la requête la plus exacte (si il y en a une) pour n'obtenir que des fichiers de séquences complètes du récepteur de l'insuline de l'homme.

1 fichier est renvoyé : AAI17173.

  • Le fichier AAA59452 contient le mot "Partial" (P majuscule) donc il est éliminé.
  • Filtrer avec ce mot est efficace mais il est difficile de gérer la casse (majuscule / minuscule).

Il n'y a pas de requête évidente à moins de consulter un grand nombre fichiers GenPept pour noter les mots à ne pas utiliser dans le filtre pour éviter d'éliminer des fichiers intéressants.

Retour haut de page

b. Récupérer la séquence FASTA du fichier AAA59452 et effectuer une recherche de séquences homologues avec BLAST.

  • Dans la page de résultats, ouvrir l'onglet "Graphic Summary".
  • Il apparaît une figure avec l'entête "Putative conserved domains have been detected, click on the image below for detailed results" : cliquer sur la figure.

Une nouvelle page s'ouvre. Comparer cette figure à celle du cours sur le récepteur de l'insuline.

Ce récepteur est constituée d'un grand nombre de domaines.

Un domaine est une région de la chaîne polypeptidique :

  • apte à se replier indépendamment
  • qui possède une fonction propre

Cliquer sur le signe "+" de la fenêtre "List of domain hits" : on obtient la séquence des différents domaines.
Dans quel domaine trouve-t-on la séquence "LGQGSFGMVY" ?
De quel domaine du récepteur s'agit-il ?

Le domaine PTKc_InsR.

Domaine catalytique à activité protéine tyrosine kinase.

Dans la figure du haut de la page, cliquer sur l'un quelconque des triangles oranges de la ligne intitulée "ATP binding site".

  • A quel domaine du récepteur de l'insuline appartient ce site ?
  • Quel est le rôle de la fixation de l'ATP ?
  • Retrouve-t-on la séquence "LGQGSFGMVY" dans l'alignement des séquences de récepteurs en bas de la page ?

"Catalytic domain of the Protein Tyrosine Kinase, Insulin Receptor"

"PTKs catalyze the transfer of the gamma-phosphoryl group from ATP to tyrosine (tyr) residues in protein substrates"

Oui, dans la partie N-terminale des séquences.

Retour haut de page

D. Interférence ARN

Voir le cours sur l'interférence ARN.

L'introduction d'ADN double brin ("double-strand DNA" - dsRNA) de plus de 30 nucléotides dans des cellules de mammifères induit la réponse interféron (activation de la protéine kinase R ("interferon-induced, double-stranded RNA-activated protein kinase") et de la 2',5'-oligoadénylate synthétase). Cette réponse entraîne la dégradation non spécifique des ARN messagers et une diminution du taux de traduction.

La conception de siRNA ("design" / "screening") nécessite que les ARN synthétisés contiennent moins de 30 nucléotides. Les siRNA avec un débordement en 3’ constitué du dinucléotide UU sont les plus puissants.

Synthese siRNA RNA interferent miRNA

Retour haut de page

Les règles de conception d’un siRNA à partir d’une séquence d’ARM messager sont :

  • siRNA targeted sequence is usually 21 nt in length.
  • Avoid regions within 50-100 bp of the start codon (ATG) and the termination codon. Targets should be located 50-100 nt downstream of the start codon.
  • Search for sequence motif AA(N19)TT or NA(N21), or NAR(N17)YNN, where : A = Adenine; T = Thymine; N = any nucleotide; R = purine (A, G); Y = pyrimidine (T, C, U).
  • Target sequences should have a [G+C] content between 30-60%.
  • Avoid stretches of 4 or more nucleotide repeats such as AAAA, CCCC.
  • Avoid intron regions, repeats and low complex sequences, single nucleotide polymorphism (SNP) sites.
  • Avoid 5'UTR and 3'UTR, although siRNAs targeting UTRs have been shown to successfully induce gene silencing.
  • Avoid sequences that share a certain degree of homology with other related or unrelated genes : perform BLAST homology search to avoid off-target effects on other genes or sequences.
  • Always design negative controls by scrambling targeted siRNA sequence. The control RNA should have the same length and nucleotide composition as the siRNA but have at least 4-5 bases mismatched to the siRNA. Make sure the scrambling will not create new homology to other genes.

EMBOSS Seqret : logiciel de conversion de formats de fichiers.

Trouver la séquence d’un siRNA dans la séquence de l’ARN messager (GenBank NM_003380) codant la vimentine de l’homme :

Uniprot : Homo sapiens vimentin mRNA

>NM_003380.3 Homo sapiens vimentin mRNA
CCCCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCGTTCGCC
TCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAG
CCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCA
CCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCC
TGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCG
TGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCC
TGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCC
GCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACA
AGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGG
GCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGC
AGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCG

Il faut trouver une séquence de 21 nucléotides dans l’ARNm cible qui commence par un dinucléotide AA.

On cherche le codon d'initiation de la transcription (AUG) : toutes séquences commençant par AA (et les 19 nucléotides suivants) constituent un site cible potentiel pour les siRNA.

Vimentine RNA interferent siRNA miRNA


Résultat pour la vimentine
séquence ciblée - ADNc ("targeted region") 5' AACTACATCGACAAGGTGCGCTT
siRNA sens 5' CUACAUCGACAAGGUGCGCdTdT
siRNA antisens 5' GCGCACCUUGUCGAUGUAGdTdT

Autres exemples
Lamine A/C
SC : 5'AACTGGACTTCCAGAAGAACATC
sens : 5'CUGGACUUCCAGAAGAACAdTdT
antisens : 5'UGUUCUUCUGGAAGUCCAGdTdT
Lamine B1
SC : 5'AACGCGCTTGGTAGAGGTGGATT
sens : 5'CGCGCUUGGUAGAGGUGGAdTdT
antisens : 5'UCCACCUCUACCAAGCGCGdTdT
GL2 Luciferase
SC : 5'AACGTACGCGGAATACTTCGATT
sens : 5'CGUACGCGGAAUACUUCGAdTdT
antisens : 5'UCGAAGUAUUCCGCGUACGdTdT
Source : Elbashir et al. (2001)

Exemples de programmes

IDT - "Custom Dicer-Substrate siRNA (DsiRNA)"

  • Entrer le nom de la séquence.
  • Coller la séquence cible.
  • Puis cliquer sur "Calculate".
  • Voir les différentes positions des siRNA sens trouvés.

siDirect

  • Entrer la séquence au format
  • Ouvrir les options : cocher les cases des options désirées, notamment le "GC content"

Retour haut de page