Déshydrogénases et pli Rossmann / calmoduline et motif "EF-hand" / insuline / siRNA
biochimej Flux RSS

Chargement de la page : "Déshydrogénases et pli Rossmann / calmoduline et motif "EF-hand" / récepteur et insuline / siRNA"

Déshydrogénase à NAD(P)+.

1. Aller au NCBI. Rechercher les séquences protéiques de la lactate déshydrogénase. Attention : anglais, abréviation, emploi des opérateurs logiques (Booléens) : "AND", "OR" et "NOT".

Avec l'option "Advanced" (lien en haut de la page), affiner la recherche avec EC et Arabidopsis thaliana dans les résultats précédents :

"#1 AND in builder" puis taper "" avec le champs "EC/RN Number" du menu déroulant.
"#2 AND in builder" puis taper "Arabidopsis thaliana" avec le champs "Organism" du menu déroulant.

≈ 110.000 résultats

≈ 1580 séquences

1 séquence : AAC02678

2. Examiner le contenu "GenPept" du fichier AAC02678.

  • Que signifie : order(72,74,77,115..119,156,158,181,185,213,268,272) ?
  • Pourquoi les acides aminés ne sont-ils pas contigus dans la séquence ?
  • Acides aminés qui constituent le site de fixation du coenzyme NAD ("NAD binding site")
  • A quoi correspond EC ?
  • Cliquer sur le lien :
    1. A quelle base de données aboutit-on ?
    2. Quelle est la réaction catalysée par cette enzyme ?
    3. De quelle voie métabolique fait-elle partie ?

EC : oxydo-réductases

  • On aboutit à la base de données Expasy
  • Réaction : pyruvate + NADH + H+ <=> lactate + NAD+
  • La fermentation lactique à l'issue de la glycolyse

Remarques :

Illustration de dépôt de fichier abusif : voir le fichier N° accession AAN87112.

Voir : algorithmes & programmes en bioinformatique.

EMBOSS Seqret : logiciel de conversion de formats de fichiers

Retour haut de page

3. Rechercher dans la base de données Uniprot le fichier correspondant au fichier obtenu au NCBI.

  • Quel est le numéro d'accession du fichier Uniprot ?
  • Quelles informations suplémentaires obtient-on ?

O23569 (O23569_ARATH)

Exemple d'informations : réaction chimique / ontologie / localisation subcellulaire / un très grand nombre de liens vers diverses bases de données (InterPro, NCBI , ...)

Dans le champs "Cross-references" : lien vers "Translation: ABI54333.1".

Vérifier avec le programme d'alignement de séquences Multalin si les séquences AAC02678 et O23569 sont identiques (dans ce cas les valeurs du paramètre "check" au dessus de l'alignement obtenu sont identiques).

  • Si ce n'est pas le cas, qu'en conclure ?
  • A quelle protéine correspond le fichier ABI54333 au NCBI ?
  • Pourquoi n'a-t-il pas été renvoyé dans la requête d'origine au NCBI ?

Différence (conservative) de 1 acide aminé : V155 => I155

Le champs "DEFINITION" contient "At4g17260 [Arabidopsis thaliana]" et pas "lactate dehydrogenase"

Retour haut de page

4. Aller à ScanProsite. Entrer la séquence FASTA de la lactate déshydrogénase AAC02678 et lancer le scan.

Page de résultats : trouver le lien vers la page de l'expression régulière (au format Prosite) du motif consensus ("consensus pattern") des déshydrogénases.


Retour haut de page

5. Aller à PHI-BLAST au NCBI.

Faire une recherche de 50 séquences homologues et/ou similaires de la lactate déshydrogénase chez l'homme (Homo sapiens - taxid:9606) en utilisant l'expression régulière du motif consensus.

Récupérez (en les cochant) les séquences FASTA des 20 résultats qui ont la E-value la plus élevée (sauf les fichiers annotés "Predicted") - [Sélectionner "FASTA (complete sequence)" dans le menu déroulant "Download"].

Voir un descriptif de Blast

6. Avec Multalin, alignez la séquence de la lactate déshydrogénase de Arabidopsis thaliana avec les 20 séquences FASTA de Homo sapiens. Le but est de mettre en exergue un motif G-X-G-X-X-G. Il faut donc "jouer" sur le choix de la matrice, les valeurs de gap et éliminer progressivement les séquences trop longues (environ une demi-douzaine : exemples : NP_001158886 BAB71710 EAW77566 NP_149972 XP_005252862), sauf celle de Arabidopsis thaliana.

Ecrire l'expression régulière la plus précise de ce motif qui tient compte de toutes les séquences conservées.

Retour haut de page

7. Illustration : structure du domaine liant le NAD(P)+ - le pli Rossmann

Voir le cours sur les déshydrogénases à NAD(P)+ pour cette partie.

Récupérer la séquence de la lactate déshydrogénase de Squalus acanthias : Uniprot P00341. Refaire l'alignement en y ajoutant cette séquence : repérer le motif spécifique de la lactate déshydrogénase de Squalus acanthias (GVGAVG)

Visualisation de la lactate déshydrogénase de Squalus acanthias à une résolution de 3 Å

Code PDB : 3LDH

Le pli Rossmann ("Rossmann fold" - en hommage à Michael Rossmann) est une structure super-secondaire (assemblage de plusieurs types de structures secondaires) : il est composé de 3 feuillets β liés à 2 hélices α de manière alternée (β-α-β-α-β).

Un pli Rossmann peut fixer 1 nucléotide.

Donc le domaine de fixation d'un dinucléotides (tel que NAD+ ou NADP+) contient 2 plis Rossmann appariés, chacun d'eux fixant l'un des nucléotides du co-facteur.

Pour faire apparaître de multiples fonctions du menu Jmol :

  • clic sur "Jmol" (Mac)
  • clic droit sur "Jmol" (PC)

Le motif consensus GXGXXG : ce motif riche en glycine forme une boucle ("glycine-rich P-loop motif") qui effectue un tour serré entre la fin du premier feuillet β (β7) et le début de l'hélice de fixation du dinucléotide (α6) au sein du pli Rossmann.

Effectuer une prédiction de structures secondaires de la séquence de lactate déshydrogénase de Arabidopsis thaliana avec un outil approprié.

Repérer les acides aminés du Pli Rossmann : sont-ils prédits dans une structure secondaire correcte ? Et ceux du motif GXGXXG ?

Exemple de logiciels de prédiction de structures secondaires : HHpred

Autres logiciels : Jpred - CFSSP - GOR

Retour haut de page

Recherche d'annotations de fonctions de la lactate déshydrogénase via l'ontologie

Voir un cours sur l'annotation et l'ontologie.

Via le TAIR   Via "Gene Ontology"
Aller au TAIR. En haut à droite, taper "L-lactate dehydrogenase" avec le champs "Gene" puis cliquer sur "Search".

Cliquer sur le lien AT4G17260.

Partie : "Annotations" / category "Biological Process" / keyword : cliquer sur "carbohydrate metabolic process". Cliquer sur le lien "TreeView".

Aller à "Gene Ontology". Taper "lactate dehydrogenase arabidopsis" dans le champs "Search GO data".

Voir : "Reference Species and Databases"

Ouvrir l'arborescence (signe "+") du dernier item : "carbohydrate metabolic process". Que siginifient les symboles "I" et "R" ?
  • Ouvrir l'arborescence "regulation of carbohydrate metabolic process".
  • Ouvrir l'arborescence "regulation of raffinose metabolic process".
  • Ouvrir l'arborescence "regulation of raffinose biosynthetic process".
  • Cliquer sur "negative regulation of raffinose biosynthetic process".

Quel est l'identifiant du mot clé ? GO:1900092

Choisir "Genes and gene products associated with GO terms".

Cliquer sur le lien AT4G17260.

Cliquer sur le lien "carbohydrate metabolic process" (GO:0005975).

Ouvrir l'onglet : "Inferred Tree View".

Cliquer sur le lien "GO Database".

Quel est le résultat ?

Remarque : "GO slims are cut-down versions of the GO ontologies containing a subset of the terms in the whole GO."

Ouvrir l'onglet : "Graph Views". Interpréter.

Aller à "Gene Ontology".

Taper "GO:1900092" dans le champs "Search GO data".

Revenir à la page GO: 0080091. Ouvrir l'onglet "Annotations".

Cliquer sur le lien LST8-1.

  • De quelle protéine s'agit-il ? Lethal with Sec Thirteen 8-1
  • Effectuer un BLAST : Q9LV27 / NP_188442

Retour haut de page

Etude de la calmoduline

1. Exemple de syntaxe PROSITE : <A-x-[ST](2)-x(0,1)-{V}

Elle se lit : Ala en position N-terminale puis n'importe quel acide aminé puis 2 fois (Ser ou Thr) puis aucun acide aminé ou n'importe quel acide aminé puis n'importe quel acide aminé sauf Val.

Ecrire la séquence suivante dans cette syntaxe :

4 Ser puis (Asp ou Ser) puis n'importe quel acide aminé puis (Asp ou Glu) puis (Glu ou Gly ou Val) puis 1 à 7 fois n'importe quel acide aminé puis (Glu ou Gly) puis 1 à 2 fois n'importe quel acide aminé puis 4 fois (Arg ou Lys).



Le motif de fixation du calcium (motif "EF-hand") est composé de 30 acides aminés et contient 2 hélices α (E et F - figurées respectivement par l'index et le pouce d'une main - figure ci-contre), reliées par une boucle.

Lors de la fixation du calcium, l'hélice F passe d'une conformation "fermée" (apo-CaM) à une conformation "ouverte" (holo-CaM).

Dans la CaM, les 4 boucles de liaison au calcium inclues dans ces motifs ont des séquences homologues :

[D/N] - x - D - G - [D/N] - G - [T/Y/Q] - x - x - x - x - E

helice helix motif EF hand calmodulin CaM

Source : PFAM : PF00036

Retour haut de page

2. Aller au NCBI. Effectuer une recherche de séquence de la calmoduline de Homo sapiens au NCBI.

Récupérer le fichier CAA36839.

Repérer les acides aminés du motif "EF - hand" dans ce fichier.

Aller à ScanProsite. Rechercher le motif consensus de fixation du calcium (motif "EF-hand") en utilisant cette séquence.

Quelle est la syntaxe PROSITE de ce motif ?


Numéro d'accession Prosite de ce motif : PS00018


Retour haut de page

3. Effectuer une recherche de séquences homologues ou similaires avec PHI-Blast à partir de cette séquence de calmoduline et du motif de fixation du calcium (format Prosite).

4. Effectuer une prédiction de structures secondaires avec un outil approprié.

5. Emettre une hypothèse pour expliquer que la calmoduline reconnait autant de cibles distinctes bien qu’il y ait une très forte homologie de séquence en acides aminés entre les calmodulines.

Retour haut de page

Dans la structure de la calmoduline, 7 atomes d'oxygène constituent le réseau de coordination du calcium :

  • 5 proviennent de la chaîne latérale d'Asp et de Glu
  • le 6ème provient du groupement carbonyle de la liaison peptidique impliquant une Gln
  • le 7ème provient d'une molécule d'eau

Géomètrie des ligands du calcium dans un motif "EF - hand":

positions ligand
X et Y chaînes latérales des acides aminés Asp et Asn
Z chaînes latérales des acides aminés Asp, Asn et Ser
- Y oxygène du groupement carbonyle de la liaison peptidique
- X molécule d'eau
-Z bidentate ou chaînes latérales des acides aminés Asp et Glu

Geometrie ligand calcium motif EF hand calmodulin CaM

Source : Lewit-Bentley & Réty (2000)

Visualisation de la calmoduline de l'homme, non complexée au calcium, à une résolution de 1,7 Å

Code PDB : 1CLL

Acides aminés de l'un des 4 motifs "EF - hand" :

  • EF1 : X = D20; Y = D22; Z = D24; -X = H2O; -Y = T26; -Z1 = E3; -Z2 = E31

Pour faire apparaître de multiples fonctions du menu Jmol :

  • clic sur "Jmol" (Mac)
  • clic droit sur "Jmol" (PC)

Retour haut de page


a. Aller au NCBI. Effectuer une recherche de récepteur de l'insuline de l'homme. Quels mots-clés faut-il employer ?

Analyser le contenu résultat du fichier dont le N° d'accession est : AAA59452.

b. Effectuer une recherche avec BLAST.

  • Dans la page de résultats, il apparaît une fenêtre avec l'entête "Putative conserved domains have been detected, click on the image below for detailed results" : cliquer sur la figure.
  • Une nouvelle page s'ouvre. Comparer cette figure à celle du cours sur le récepteur de l'insuline.
  • Cliquer sur le signe "+" de la fenêtre "List of domain hits" : on obtient la séquence des différents domaines. Dans quel domaine trouve-t-on la séquence "LGQGSFGMVY" ?
  • Cliquer sur un triangle orange "ATP binding site". Retrouve-t-on la séquence "LGQGSFGMVY" dans celle du récepteur (voir tout en bas) ?

c. Rechercher les fichiers dont les N° d'accession sont : AAA59179 NP_000198 NP_001008996 Q8HXV2 P30407 AEG19452 ABB89743 ABB89749 ABI63346

Effectuer un alignement multiple. Tirer des conclusions.

Retour haut de page

Interférence ARN

Voir le cours.

L'introduction d'ADN double brin ("double-strand DNA" - dsRNA) de plus de 30 nucléotides dans des cellules de mammifères induit la réponse interféron (activation de la protéine kinase R ("interferon-induced, double-stranded RNA-activated protein kinase") et de la 2',5'-oligoadénylate synthétase). Cette réponse entraîne la dégradation non spécifique des ARN messagers et une diminution du taux de traduction.

La conception de siRNA ("design" / "screening") nécessite que les ARN synthétisés contiennent moins de 30 nucléotides. Les siRNA avec un débordement en 3’ constitué du dinucléotide UU sont les plus puissants.

Synthese siRNA RNA interferent miRNA

Les règles de conception d’un siRNA à partir d’une séquence d’ARM messager sont :

  • siRNA targeted sequence is usually 21 nt in length.
  • Avoid regions within 50-100 bp of the start codon (ATG) and the termination codon. Targets should be located 50-100 nt downstream of the start codon.
  • Search for sequence motif AA(N19)TT or NA(N21), or NAR(N17)YNN, where : A = Adenine; T = Thymine; N = any nucleotide; R = purine (A, G); Y = pyrimidine (T, C, U).
  • Target sequences should have a [G+C] content between 30-60%.
  • Avoid stretches of 4 or more nucleotide repeats such as AAAA, CCCC.
  • Avoid intron regions, repeats and low complex sequences, single nucleotide polymorphism (SNP) sites.
  • Avoid 5'UTR and 3'UTR, although siRNAs targeting UTRs have been shown to successfully induce gene silencing.
  • Avoid sequences that share a certain degree of homology with other related or unrelated genes : perform BLAST homology search to avoid off-target effects on other genes or sequences.
  • Always design negative controls by scrambling targeted siRNA sequence. The control RNA should have the same length and nucleotide composition as the siRNA but have at least 4-5 bases mismatched to the siRNA. Make sure the scrambling will not create new homology to other genes.

EMBOSS Seqret : logiciel de conversion de formats de fichiers.

Trouver la séquence d’un siRNA dans la séquence de l’ARN messager codant la vimentine de l’homme :

Uniprot : Homo sapiens vimentin mRNA

GenBank : NM_003380

>NM_003380.3 Homo sapiens vimentin mRNA

Il faut trouver une séquence de 21 nucléotides dans l’ARNm cible qui commence par un dinucléotide AA.

On cherche le codon d'initiation de la transcription (AUG) : toutes séquences commençant par AA (et les 19 nucléotides suivants) constituent un site cible potentiel pour les siRNA.

Vimentine RNA interferent siRNA miRNA

Résultat pour la vimentine
séquence ciblée - ADNc ("targeted region") 5' AACTACATCGACAAGGTGCGCTT

Autres exemples
Lamine A/C
Lamine B1
GL2 Luciferase
Source : Elbashir et al. (2001)

Exemples de programmes

IDT - "Design siRNA following the rules of either Thomas Tuschl or Andrew Fire" : conception de dsRNA 27mers.

  • Entrer le nom de la séquence.
  • Coller la séquence cible.
  • Puis cliquer sur "Calculate".
  • Voir les différentes positions des siRNA sens trouvés.


  • Entrer la séquence au format
  • Ouvrir les options : cocher les cases des options désirées, notamment le "GC content"

TROD - "T7 RNAi Oligo Designer"


  • Vérifier la taxonomie (fenêtre de gauche) et le type d'information soumise.
  • Taper : NM_003380 dans la fenêtre "C. Target mRNA information".
  • Puis "Submit target mRNA information".
  • Reherche d'isoformes : cliquer sur le bouton "Find isoforms".
  • Cliquer sur le bouton "Design".
  • Paramètrage : modifier les valeurs en fonction de la séquence cible et des régles énoncées ci-dessus.
  • Cliquer sur le bouton "Submit design condition".
  • Voir le descriptif des colonnes en bas ("Column description").


Liens Internet et références bibliographiques
The RNAi Web RNAi Web
Napoli et al. (1990) "Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans" Plant Cell 2, 279 - 289 Article

Retour haut de page